Incidental Mutation 'PIT4418001:D2hgdh'
ID555552
Institutional Source Beutler Lab
Gene Symbol D2hgdh
Ensembl Gene ENSMUSG00000073609
Gene NameD-2-hydroxyglutarate dehydrogenase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location93824909-93852348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93838868 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 385 (H385Y)
Ref Sequence ENSEMBL: ENSMUSP00000108502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097633] [ENSMUST00000112881] [ENSMUST00000188532] [ENSMUST00000189154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097633
AA Change: H363Y

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095235
Gene: ENSMUSG00000073609
AA Change: H363Y

DomainStartEndE-ValueType
Pfam:FAD_binding_4 114 253 2.7e-35 PFAM
Pfam:FAD-oxidase_C 289 530 7.3e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112881
AA Change: H385Y

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108502
Gene: ENSMUSG00000073609
AA Change: H385Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:FAD_binding_4 136 275 7e-36 PFAM
Pfam:FAD-oxidase_C 311 552 4.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186783
Predicted Effect probably damaging
Transcript: ENSMUST00000188532
AA Change: H50Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000189154
SMART Domains Protein: ENSMUSP00000140506
Gene: ENSMUSG00000073609

DomainStartEndE-ValueType
Pfam:FAD_binding_4 114 179 3.2e-10 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes D-2hydroxyglutarate dehydrogenase, a mitochondrial enzyme belonging to the FAD-binding oxidoreductase/transferase type 4 family. This enzyme, which is most active in liver and kidney but also active in heart and brain, converts D-2-hydroxyglutarate to 2-ketoglutarate. Mutations in this gene are present in D-2-hydroxyglutaric aciduria, a rare recessive neurometabolic disorder causing developmental delay, epilepsy, hypotonia, and dysmorphic features. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in D2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:D2hgdh APN 1 93829889 missense probably benign 0.06
IGL02506:D2hgdh APN 1 93829785 missense probably damaging 0.98
IGL02995:D2hgdh APN 1 93829836 missense probably damaging 1.00
PIT1430001:D2hgdh UTSW 1 93826279 unclassified probably benign
R0069:D2hgdh UTSW 1 93835287 missense possibly damaging 0.93
R0080:D2hgdh UTSW 1 93826455 missense probably damaging 0.97
R0538:D2hgdh UTSW 1 93826377 missense probably damaging 0.97
R2267:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R2268:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R2269:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R4419:D2hgdh UTSW 1 93829813 missense probably damaging 1.00
R5322:D2hgdh UTSW 1 93829898 critical splice donor site probably null
R6018:D2hgdh UTSW 1 93826460 missense probably benign 0.03
R6264:D2hgdh UTSW 1 93826455 missense probably damaging 0.97
R6750:D2hgdh UTSW 1 93826407 missense probably benign 0.01
R6814:D2hgdh UTSW 1 93835303 missense possibly damaging 0.94
R7058:D2hgdh UTSW 1 93835374 missense probably damaging 1.00
R7473:D2hgdh UTSW 1 93838078 missense probably damaging 0.96
R7683:D2hgdh UTSW 1 93838965 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCATGTGAAATTTAGCGAGC -3'
(R):5'- GAGGTGTCTTGGCCATCTAC -3'

Sequencing Primer
(F):5'- TAGCGAGCCTGAATGCTTC -3'
(R):5'- TACCCCATCTCTGCAGGAC -3'
Posted On2019-06-07