Incidental Mutation 'PIT4418001:Wdr64'
ID555555
Institutional Source Beutler Lab
Gene Symbol Wdr64
Ensembl Gene ENSMUSG00000026523
Gene NameWD repeat domain 64
Synonyms4930511H01Rik, 4930415O10Rik
Accession Numbers

Ncbi RefSeq: NM_029453.2; MGI:1923070

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location175698593-175815734 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 175743594 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 331 (Y331*)
Ref Sequence ENSEMBL: ENSMUSP00000128678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094288] [ENSMUST00000171939] [ENSMUST00000194087]
Predicted Effect probably null
Transcript: ENSMUST00000094288
AA Change: Y341*
SMART Domains Protein: ENSMUSP00000091846
Gene: ENSMUSG00000026523
AA Change: Y341*

DomainStartEndE-ValueType
WD40 118 159 2.65e1 SMART
WD40 162 200 2.13e1 SMART
low complexity region 259 271 N/A INTRINSIC
Blast:WD40 277 316 5e-19 BLAST
WD40 323 361 2.4e-1 SMART
WD40 365 404 8.29e-1 SMART
WD40 407 449 1.7e2 SMART
WD40 457 493 1.19e1 SMART
WD40 497 538 4.55e-3 SMART
WD40 643 684 3.31e0 SMART
WD40 742 806 7.4e0 SMART
Blast:WD40 811 851 7e-17 BLAST
WD40 864 903 4.62e-4 SMART
Blast:XPGN 921 964 9e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171939
AA Change: Y331*
SMART Domains Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: Y331*

DomainStartEndE-ValueType
WD40 151 190 5.73e0 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 306 4e-19 BLAST
WD40 313 351 2.4e-1 SMART
WD40 355 394 8.29e-1 SMART
WD40 397 439 1.7e2 SMART
WD40 447 483 1.19e1 SMART
WD40 487 528 4.55e-3 SMART
WD40 633 674 3.31e0 SMART
WD40 732 796 7.4e0 SMART
Blast:WD40 801 841 5e-17 BLAST
WD40 854 893 4.62e-4 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000194087
AA Change: Y331*
SMART Domains Protein: ENSMUSP00000141740
Gene: ENSMUSG00000026523
AA Change: Y331*

DomainStartEndE-ValueType
WD40 151 190 3.6e-2 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 305 5e-19 BLAST
WD40 313 351 1.5e-3 SMART
WD40 355 394 5.2e-3 SMART
WD40 397 439 1.1e0 SMART
WD40 447 483 7.6e-2 SMART
WD40 487 528 2.9e-5 SMART
WD40 633 674 2.1e-2 SMART
WD40 732 796 4.7e-2 SMART
Blast:WD40 801 841 6e-17 BLAST
WD40 854 893 2.9e-6 SMART
Blast:XPGN 911 954 1e-18 BLAST
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Wdr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Wdr64 APN 1 175698800 missense probably benign 0.00
IGL00902:Wdr64 APN 1 175728825 missense probably damaging 1.00
IGL01347:Wdr64 APN 1 175720333 missense probably benign 0.12
IGL01353:Wdr64 APN 1 175731585 missense probably damaging 0.96
IGL01583:Wdr64 APN 1 175767156 critical splice donor site probably null
IGL01643:Wdr64 APN 1 175772311 missense probably damaging 1.00
IGL01673:Wdr64 APN 1 175800356 missense possibly damaging 0.68
IGL01992:Wdr64 APN 1 175706071 missense probably damaging 1.00
IGL02613:Wdr64 APN 1 175767047 nonsense probably null
IGL02834:Wdr64 APN 1 175805849 splice site probably benign
IGL03214:Wdr64 APN 1 175743635 splice site probably benign
IGL03305:Wdr64 APN 1 175755586 missense possibly damaging 0.94
IGL03308:Wdr64 APN 1 175766996 unclassified probably benign
R0036:Wdr64 UTSW 1 175728930 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0079:Wdr64 UTSW 1 175795102 missense probably benign 0.02
R0380:Wdr64 UTSW 1 175769642 splice site probably benign
R0486:Wdr64 UTSW 1 175795203 splice site probably benign
R0520:Wdr64 UTSW 1 175726392 missense probably damaging 1.00
R0598:Wdr64 UTSW 1 175805899 missense probably damaging 1.00
R0711:Wdr64 UTSW 1 175772185 missense probably benign 0.39
R0746:Wdr64 UTSW 1 175792973 missense possibly damaging 0.92
R0927:Wdr64 UTSW 1 175793081 missense probably damaging 0.97
R0947:Wdr64 UTSW 1 175775749 missense probably benign
R1014:Wdr64 UTSW 1 175755626 missense probably damaging 1.00
R1332:Wdr64 UTSW 1 175795140 missense possibly damaging 0.82
R1416:Wdr64 UTSW 1 175806002 missense probably benign 0.01
R1421:Wdr64 UTSW 1 175767150 missense possibly damaging 0.85
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1796:Wdr64 UTSW 1 175717331 missense probably damaging 1.00
R1797:Wdr64 UTSW 1 175812019 missense probably damaging 1.00
R2145:Wdr64 UTSW 1 175767095 missense probably benign 0.01
R2321:Wdr64 UTSW 1 175795087 missense possibly damaging 0.57
R2449:Wdr64 UTSW 1 175698913 missense probably benign
R4049:Wdr64 UTSW 1 175805856 missense probably benign 0.21
R4155:Wdr64 UTSW 1 175769606 missense probably benign 0.03
R4624:Wdr64 UTSW 1 175772263 missense probably benign
R4661:Wdr64 UTSW 1 175726494 missense probably damaging 1.00
R4711:Wdr64 UTSW 1 175799229 missense probably damaging 1.00
R4891:Wdr64 UTSW 1 175698779 unclassified probably benign
R4925:Wdr64 UTSW 1 175724702 splice site probably null
R4943:Wdr64 UTSW 1 175720316 missense probably benign 0.01
R5000:Wdr64 UTSW 1 175726375 splice site probably null
R5001:Wdr64 UTSW 1 175792959 critical splice acceptor site probably null
R5143:Wdr64 UTSW 1 175726413 missense probably damaging 1.00
R5395:Wdr64 UTSW 1 175755598 missense probably damaging 1.00
R5813:Wdr64 UTSW 1 175812057 missense possibly damaging 0.89
R6014:Wdr64 UTSW 1 175805990 missense possibly damaging 0.56
R6417:Wdr64 UTSW 1 175726390 missense probably damaging 1.00
R6456:Wdr64 UTSW 1 175785609 critical splice donor site probably null
R6555:Wdr64 UTSW 1 175720290 missense probably damaging 1.00
R6576:Wdr64 UTSW 1 175805928 missense possibly damaging 0.82
R6797:Wdr64 UTSW 1 175810610 critical splice donor site probably null
R6891:Wdr64 UTSW 1 175706068 missense probably damaging 1.00
R6959:Wdr64 UTSW 1 175705989 missense probably damaging 1.00
R7205:Wdr64 UTSW 1 175789933 missense probably benign 0.34
R7252:Wdr64 UTSW 1 175775674 missense probably benign 0.00
R7552:Wdr64 UTSW 1 175785581 missense possibly damaging 0.71
R7732:Wdr64 UTSW 1 175789929 missense probably benign
R7777:Wdr64 UTSW 1 175789998 missense possibly damaging 0.71
R7780:Wdr64 UTSW 1 175728976 missense probably damaging 1.00
R7810:Wdr64 UTSW 1 175731526 missense probably benign 0.01
R7833:Wdr64 UTSW 1 175763945 missense probably damaging 1.00
R7843:Wdr64 UTSW 1 175812102 missense probably benign 0.00
R7887:Wdr64 UTSW 1 175785545 missense not run
R7991:Wdr64 UTSW 1 175726485 missense probably benign 0.36
R8124:Wdr64 UTSW 1 175799278 splice site probably null
R8129:Wdr64 UTSW 1 175775588 missense probably damaging 0.96
Z1088:Wdr64 UTSW 1 175705985 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TAGGTATCCTGATCCCTCGG -3'
(R):5'- GAAGGCTTTGTTAAAGTATGACTCC -3'

Sequencing Primer
(F):5'- AGGTATCCTGATCCCTCGGAATTAG -3'
(R):5'- CATATCCAATACCTGCAGTGAATGG -3'
Posted On2019-06-07