Incidental Mutation 'PIT4418001:Dtl'
ID555556
Institutional Source Beutler Lab
Gene Symbol Dtl
Ensembl Gene ENSMUSG00000037474
Gene Namedenticleless E3 ubiquitin protein ligase
Synonyms5730564G15Rik, 2810047L02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4418001 (G1)
Quality Score211.009
Status Not validated
Chromosome1
Chromosomal Location191537356-191575544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 191541317 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 493 (L493H)
Ref Sequence ENSEMBL: ENSMUSP00000027933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027933] [ENSMUST00000195650]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027933
AA Change: L493H

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027933
Gene: ENSMUSG00000037474
AA Change: L493H

DomainStartEndE-ValueType
Blast:WD40 30 80 1e-24 BLAST
WD40 87 126 2.61e-3 SMART
WD40 129 169 8.04e-4 SMART
WD40 205 244 8.29e-1 SMART
Blast:WD40 265 299 1e-11 BLAST
WD40 304 345 1.29e-2 SMART
WD40 349 389 1.07e-8 SMART
low complexity region 427 454 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
low complexity region 674 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195650
SMART Domains Protein: ENSMUSP00000141218
Gene: ENSMUSG00000037474

DomainStartEndE-ValueType
Blast:WD40 30 80 2e-26 BLAST
WD40 87 126 1.6e-5 SMART
Blast:WD40 129 154 7e-10 BLAST
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutation of this gene results in very early embryonic lethality around or before E1.5. In vitro siRNA knockdown experiments show that the gene is essential cell survival and cell cycle progression to allow proper blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Dtl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Dtl APN 1 191546626 splice site probably null
IGL01069:Dtl APN 1 191561539 critical splice acceptor site probably null
IGL01135:Dtl APN 1 191548330 missense probably damaging 1.00
IGL01307:Dtl APN 1 191570699 missense possibly damaging 0.78
IGL01461:Dtl APN 1 191546617 missense possibly damaging 0.88
IGL01809:Dtl APN 1 191548303 missense probably damaging 1.00
IGL01958:Dtl APN 1 191568377 missense probably damaging 1.00
IGL02217:Dtl APN 1 191568314 missense probably damaging 1.00
IGL02408:Dtl APN 1 191541240 missense probably benign 0.00
IGL02445:Dtl APN 1 191558060 critical splice donor site probably null
IGL02661:Dtl APN 1 191541371 missense probably benign 0.09
IGL02864:Dtl APN 1 191556826 missense probably benign 0.04
IGL02897:Dtl APN 1 191541544 splice site probably benign
IGL03069:Dtl APN 1 191556896 splice site probably benign
R0370:Dtl UTSW 1 191575350 missense probably benign 0.05
R0513:Dtl UTSW 1 191569707 nonsense probably null
R1386:Dtl UTSW 1 191569717 missense probably damaging 1.00
R1424:Dtl UTSW 1 191561537 missense probably benign 0.13
R1575:Dtl UTSW 1 191561546 splice site probably null
R2128:Dtl UTSW 1 191558110 missense probably damaging 0.99
R2297:Dtl UTSW 1 191541095 missense probably benign 0.41
R2344:Dtl UTSW 1 191548378 missense probably benign 0.00
R3121:Dtl UTSW 1 191553063 nonsense probably null
R3808:Dtl UTSW 1 191548354 missense probably damaging 1.00
R4722:Dtl UTSW 1 191556841 missense possibly damaging 0.52
R4753:Dtl UTSW 1 191569703 missense probably damaging 1.00
R4904:Dtl UTSW 1 191568345 missense probably damaging 0.99
R4965:Dtl UTSW 1 191546565 missense possibly damaging 0.93
R5068:Dtl UTSW 1 191568373 missense probably damaging 1.00
R5119:Dtl UTSW 1 191541506 missense probably damaging 1.00
R5872:Dtl UTSW 1 191546568 missense probably benign 0.00
R5911:Dtl UTSW 1 191568407 missense probably damaging 1.00
R5992:Dtl UTSW 1 191568572 splice site probably null
R6425:Dtl UTSW 1 191546623 missense probably benign 0.02
R7403:Dtl UTSW 1 191563173 missense probably damaging 1.00
X0018:Dtl UTSW 1 191568410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCTTGAGTCAAGACG -3'
(R):5'- AGAGTACTCCTGCCAAAGCTC -3'

Sequencing Primer
(F):5'- AGCTTGAGTCAAGACGCCTCTTC -3'
(R):5'- TCCTGCCAAAGCTCCCAGAG -3'
Posted On2019-06-07