Incidental Mutation 'PIT4418001:Cr2'
ID 555557
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # PIT4418001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 194839760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 556 (M556L)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082321
AA Change: M556L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: M556L

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193356
AA Change: M259L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: M259L

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
AA Change: M556L

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: M556L

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: M932L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,816,630 (GRCm39) Y100C possibly damaging Het
Adamtsl1 T C 4: 86,161,961 (GRCm39) Y365H probably damaging Het
Atad2b A T 12: 5,074,587 (GRCm39) I1049F probably benign Het
Atg9b A T 5: 24,590,513 (GRCm39) S859T possibly damaging Het
Banp G A 8: 122,732,365 (GRCm39) A380T probably damaging Het
Brinp3 C T 1: 146,777,161 (GRCm39) T536I probably damaging Het
Cacna1c T C 6: 118,631,384 (GRCm39) E1155G Het
Capn12 T C 7: 28,585,961 (GRCm39) S270P probably benign Het
Cbs A T 17: 31,834,495 (GRCm39) I498N possibly damaging Het
Cep68 T C 11: 20,189,731 (GRCm39) K427R probably benign Het
Cobl G A 11: 12,206,240 (GRCm39) T545I possibly damaging Het
Crebbp A G 16: 3,932,689 (GRCm39) S1068P probably benign Het
D2hgdh C T 1: 93,766,590 (GRCm39) H385Y possibly damaging Het
Dennd1b T C 1: 139,008,999 (GRCm39) L159P Het
Dnajb4 A T 3: 151,899,134 (GRCm39) F31I possibly damaging Het
Dnajc16 A G 4: 141,498,260 (GRCm39) F369S probably damaging Het
Dtl A T 1: 191,273,429 (GRCm39) L493H possibly damaging Het
Efcab5 T A 11: 77,022,877 (GRCm39) Q612L possibly damaging Het
Efr3b A T 12: 4,030,490 (GRCm39) L407Q possibly damaging Het
Ehbp1 T A 11: 22,003,494 (GRCm39) Q1085L probably damaging Het
Ell T C 8: 71,034,331 (GRCm39) V199A probably damaging Het
Elmod2 G T 8: 84,048,171 (GRCm39) T97K probably benign Het
Epn3 T C 11: 94,386,956 (GRCm39) E138G probably damaging Het
Esf1 A T 2: 140,001,697 (GRCm39) F383L probably benign Het
Fam193a A T 5: 34,597,879 (GRCm39) T559S probably damaging Het
Galr2 T C 11: 116,174,084 (GRCm39) V238A probably benign Het
Gm3476 T C 14: 6,118,411 (GRCm38) I237M probably benign Het
Gm5160 A T 18: 14,558,339 (GRCm39) I139F probably damaging Het
Gpr15 T C 16: 58,538,313 (GRCm39) T259A probably benign Het
Iffo1 A G 6: 125,126,746 (GRCm39) K293E possibly damaging Het
Ikbip T A 10: 90,932,395 (GRCm39) H346Q probably benign Het
Il4ra G A 7: 125,175,510 (GRCm39) G573S probably benign Het
Ing2 A T 8: 48,122,125 (GRCm39) M141K probably benign Het
Itga6 T C 2: 71,664,414 (GRCm39) S517P probably benign Het
Itprid1 T G 6: 55,945,330 (GRCm39) S684A probably damaging Het
Kcnab1 A G 3: 65,265,741 (GRCm39) E295G probably benign Het
Klhl21 A C 4: 152,099,835 (GRCm39) Y515S possibly damaging Het
Lcn9 A T 2: 25,714,553 (GRCm39) Y139F probably damaging Het
Mcemp1 G T 8: 3,717,052 (GRCm39) L64F probably null Het
Mos T C 4: 3,870,814 (GRCm39) D334G possibly damaging Het
Myo9b T G 8: 71,775,591 (GRCm39) F338V probably damaging Het
Nefl G A 14: 68,323,979 (GRCm39) V406M probably damaging Het
Nfam1 C A 15: 82,885,689 (GRCm39) R181L probably damaging Het
Ntn5 A G 7: 45,335,925 (GRCm39) R119G probably damaging Het
Or12e10 G T 2: 87,640,938 (GRCm39) C258F probably damaging Het
Or5b101 A T 19: 13,005,095 (GRCm39) Y199* probably null Het
Or7a40 T C 16: 16,491,719 (GRCm39) N42S probably damaging Het
Plch2 A T 4: 155,073,960 (GRCm39) V914E probably damaging Het
Ppp1r12c T C 7: 4,504,266 (GRCm39) Q111R probably null Het
Ptchd3 T A 11: 121,732,566 (GRCm39) Y485* probably null Het
Ptchd4 T A 17: 42,813,980 (GRCm39) I627N probably damaging Het
Retnlb T C 16: 48,637,631 (GRCm39) V19A probably benign Het
Rimbp2 T A 5: 128,857,425 (GRCm39) T809S probably benign Het
Sema6c T A 3: 95,077,401 (GRCm39) D404E possibly damaging Het
Slc22a16 C T 10: 40,479,821 (GRCm39) A631V unknown Het
Snai3 A T 8: 123,183,073 (GRCm39) H157Q probably benign Het
Snx15 T C 19: 6,173,961 (GRCm39) Y52C probably damaging Het
Strbp T C 2: 37,535,504 (GRCm39) E68G probably benign Het
Sun1 T A 5: 139,212,343 (GRCm39) D155E probably damaging Het
Susd2 T C 10: 75,474,183 (GRCm39) D627G probably benign Het
Tas2r108 T A 6: 40,470,614 (GRCm39) I30K probably damaging Het
Tmc2 T C 2: 130,090,571 (GRCm39) V639A probably damaging Het
Trmt1 T C 8: 85,424,299 (GRCm39) Y445H probably damaging Het
Ttn A T 2: 76,597,554 (GRCm39) N19786K probably damaging Het
Vmn1r79 T G 7: 11,910,766 (GRCm39) V216G probably damaging Het
Wdr64 C A 1: 175,571,160 (GRCm39) Y331* probably null Het
Zfyve28 A T 5: 34,390,721 (GRCm39) V180E probably damaging Het
Zic4 C T 9: 91,261,447 (GRCm39) T234I possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TACACCGGATCTGACTGCTTC -3'
(R):5'- CACCATTCACAAATAACATGGTGAG -3'

Sequencing Primer
(F):5'- ATTGTCAGTGAGCTTGACTCC -3'
(R):5'- CATGGTGAGAAATGCTGCACTTC -3'
Posted On 2019-06-07