Incidental Mutation 'PIT4418001:Cr2'
ID555557
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 195157452 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 556 (M556L)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably benign
Transcript: ENSMUST00000082321
AA Change: M556L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: M556L

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193356
AA Change: M259L

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: M259L

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
AA Change: M556L

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: M556L

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: M932L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TACACCGGATCTGACTGCTTC -3'
(R):5'- CACCATTCACAAATAACATGGTGAG -3'

Sequencing Primer
(F):5'- ATTGTCAGTGAGCTTGACTCC -3'
(R):5'- CATGGTGAGAAATGCTGCACTTC -3'
Posted On2019-06-07