Incidental Mutation 'PIT4418001:Fam193a'
ID555575
Institutional Source Beutler Lab
Gene Symbol Fam193a
Ensembl Gene ENSMUSG00000037210
Gene Namefamily with sequence similarity 193, member A
Synonyms
Accession Numbers

Ncbi RefSeq: NM_001243123.1; MGI:2447768

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #PIT4418001 (G1)
Quality Score196.009
Status Not validated
Chromosome5
Chromosomal Location34369933-34486456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34440535 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 559 (T559S)
Ref Sequence ENSEMBL: ENSMUSP00000138082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094867] [ENSMUST00000180376] [ENSMUST00000202503]
Predicted Effect probably damaging
Transcript: ENSMUST00000094867
AA Change: T273S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092463
Gene: ENSMUSG00000037210
AA Change: T273S

DomainStartEndE-ValueType
coiled coil region 113 141 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 347 368 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 608 643 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 763 785 N/A INTRINSIC
low complexity region 819 832 N/A INTRINSIC
coiled coil region 879 946 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1052 1063 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
Pfam:FAM193_C 1174 1230 3.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180376
AA Change: T559S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210
AA Change: T559S

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201005
Predicted Effect probably benign
Transcript: ENSMUST00000202503
SMART Domains Protein: ENSMUSP00000143922
Gene: ENSMUSG00000037210

DomainStartEndE-ValueType
coiled coil region 29 57 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
Allele List at MGI

All alleles(19) : Gene trapped(19)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Fam193a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Fam193a APN 5 34431193 missense probably damaging 0.99
IGL02111:Fam193a APN 5 34410657 missense possibly damaging 0.72
IGL02139:Fam193a APN 5 34444737 missense probably benign 0.12
IGL02218:Fam193a APN 5 34443588 missense possibly damaging 0.68
BB010:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
BB020:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
P0017:Fam193a UTSW 5 34440463 missense probably damaging 1.00
R0172:Fam193a UTSW 5 34465613 missense probably damaging 0.97
R0413:Fam193a UTSW 5 34466208 missense possibly damaging 0.83
R0512:Fam193a UTSW 5 34426391 missense probably damaging 1.00
R0735:Fam193a UTSW 5 34439378 missense possibly damaging 0.85
R0764:Fam193a UTSW 5 34443341 missense probably damaging 0.99
R0904:Fam193a UTSW 5 34462143 missense probably damaging 1.00
R1756:Fam193a UTSW 5 34466292 missense possibly damaging 0.91
R1765:Fam193a UTSW 5 34436497 missense probably damaging 0.99
R1766:Fam193a UTSW 5 34462131 missense probably damaging 0.99
R1845:Fam193a UTSW 5 34443372 missense possibly damaging 0.91
R2051:Fam193a UTSW 5 34462150 missense probably benign 0.19
R2483:Fam193a UTSW 5 34465758 missense possibly damaging 0.96
R3014:Fam193a UTSW 5 34465672 missense probably benign 0.33
R4523:Fam193a UTSW 5 34443371 missense probably benign 0.07
R4723:Fam193a UTSW 5 34420786 missense probably benign 0.04
R4823:Fam193a UTSW 5 34459028 missense probably damaging 1.00
R4826:Fam193a UTSW 5 34436531 missense probably damaging 1.00
R4863:Fam193a UTSW 5 34466205 missense possibly damaging 0.86
R5331:Fam193a UTSW 5 34465571 splice site probably null
R5364:Fam193a UTSW 5 34466253 missense probably benign 0.01
R5564:Fam193a UTSW 5 34420855 missense probably damaging 0.98
R5580:Fam193a UTSW 5 34420788 missense probably benign 0.33
R5784:Fam193a UTSW 5 34466223 missense probably damaging 0.99
R5933:Fam193a UTSW 5 34465680 missense probably damaging 0.98
R5949:Fam193a UTSW 5 34440472 missense possibly damaging 0.82
R6106:Fam193a UTSW 5 34459030 missense possibly damaging 0.67
R6181:Fam193a UTSW 5 34443540 splice site probably null
R7095:Fam193a UTSW 5 34458034 missense probably damaging 0.99
R7109:Fam193a UTSW 5 34465821 missense possibly damaging 0.86
R7344:Fam193a UTSW 5 34485730 missense possibly damaging 0.71
R7401:Fam193a UTSW 5 34465635 missense possibly damaging 0.72
R7453:Fam193a UTSW 5 34464116 missense possibly damaging 0.72
R7456:Fam193a UTSW 5 34420788 missense possibly damaging 0.86
R7648:Fam193a UTSW 5 34431182 missense probably damaging 0.99
R7768:Fam193a UTSW 5 34465791 missense possibly damaging 0.85
R7783:Fam193a UTSW 5 34431180 missense probably damaging 0.99
R7818:Fam193a UTSW 5 34465653 missense possibly damaging 0.72
R7852:Fam193a UTSW 5 34410817 missense probably benign 0.01
R7853:Fam193a UTSW 5 34440129 missense probably benign 0.12
R7894:Fam193a UTSW 5 34440533 missense possibly damaging 0.92
R7933:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
R7957:Fam193a UTSW 5 34462086 missense probably damaging 1.00
R8191:Fam193a UTSW 5 34440573 missense probably damaging 0.96
R8281:Fam193a UTSW 5 34443436 missense unknown
Z1088:Fam193a UTSW 5 34420895 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGACTGCAGCCTCTCACAC -3'
(R):5'- ACATTTCCCTGCATACCAACTG -3'

Sequencing Primer
(F):5'- ACATCCTTACTTGTGGTATCATGGAC -3'
(R):5'- AACAGCATCAGTTTGGGTTTAC -3'
Posted On2019-06-07