Incidental Mutation 'PIT4418001:Tas2r108'
ID555578
Institutional Source Beutler Lab
Gene Symbol Tas2r108
Ensembl Gene ENSMUSG00000037140
Gene Nametaste receptor, type 2, member 108
SynonymsmGR08, T2R108, T2r8, mt2r8, T2R8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40493529-40494541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40493680 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 30 (I30K)
Ref Sequence ENSEMBL: ENSMUSP00000044089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038750] [ENSMUST00000064932]
Predicted Effect probably damaging
Transcript: ENSMUST00000038750
AA Change: I30K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044089
Gene: ENSMUSG00000037140
AA Change: I30K

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064932
SMART Domains Protein: ENSMUSP00000063743
Gene: ENSMUSG00000052850

DomainStartEndE-ValueType
Pfam:TAS2R 18 320 2.5e-91 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. These apparently intronless genes encode a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Tas2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Tas2r108 APN 6 40493751 missense possibly damaging 0.90
IGL01389:Tas2r108 APN 6 40493932 missense possibly damaging 0.89
IGL01603:Tas2r108 APN 6 40493786 missense possibly damaging 0.96
R1562:Tas2r108 UTSW 6 40494066 splice site probably null
R1582:Tas2r108 UTSW 6 40493632 missense probably benign 0.45
R4544:Tas2r108 UTSW 6 40493808 missense probably benign 0.00
R5579:Tas2r108 UTSW 6 40494087 missense probably benign 0.01
R7840:Tas2r108 UTSW 6 40493856 missense possibly damaging 0.76
X0027:Tas2r108 UTSW 6 40493671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCCTCTTAGACCAGAAATG -3'
(R):5'- TTTGCATCCAGAAACTTCCAAC -3'

Sequencing Primer
(F):5'- CTCTTAGACCAGAAATGGTGTTTGCC -3'
(R):5'- GCATCCAGAAACTTCCAACACAATAG -3'
Posted On2019-06-07