Incidental Mutation 'PIT4418001:Ppp1r12c'
ID555583
Institutional Source Beutler Lab
Gene Symbol Ppp1r12c
Ensembl Gene ENSMUSG00000019254
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12C
Synonyms2410197A17Rik, Mbs85
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #PIT4418001 (G1)
Quality Score166.03
Status Not validated
Chromosome7
Chromosomal Location4481520-4501680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4501267 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 111 (Q111R)
Ref Sequence ENSEMBL: ENSMUSP00000013886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013886] [ENSMUST00000071798] [ENSMUST00000108587] [ENSMUST00000124248] [ENSMUST00000125220] [ENSMUST00000163710] [ENSMUST00000166161] [ENSMUST00000178163]
Predicted Effect probably null
Transcript: ENSMUST00000013886
AA Change: Q111R

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254
AA Change: Q111R

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071798
SMART Domains Protein: ENSMUSP00000071704
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108587
SMART Domains Protein: ENSMUSP00000104228
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 205 3e-36 PFAM
Pfam:Troponin 197 260 4.8e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124248
AA Change: Q32R

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254
AA Change: Q32R

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125220
AA Change: Q88R

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000163710
SMART Domains Protein: ENSMUSP00000129626
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
coiled coil region 2 29 N/A INTRINSIC
Pfam:Troponin 57 199 1.9e-39 PFAM
low complexity region 235 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166161
SMART Domains Protein: ENSMUSP00000125795
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Troponin 56 198 3.4e-40 PFAM
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178163
SMART Domains Protein: ENSMUSP00000137198
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 40 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of myosin phosphatase. The encoded protein regulates the catalytic activity of protein phosphatase 1 delta and assembly of the actin cytoskeleton. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Ppp1r12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ppp1r12c APN 7 4497345 splice site probably benign
IGL01419:Ppp1r12c APN 7 4486352 splice site probably null
IGL02126:Ppp1r12c APN 7 4489859 missense probably benign 0.43
IGL03388:Ppp1r12c APN 7 4482070 unclassified probably benign
R0523:Ppp1r12c UTSW 7 4489772 missense probably damaging 1.00
R0815:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R0863:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R1413:Ppp1r12c UTSW 7 4484444 splice site probably null
R1522:Ppp1r12c UTSW 7 4497425 missense probably damaging 1.00
R1835:Ppp1r12c UTSW 7 4483651 missense probably damaging 1.00
R2004:Ppp1r12c UTSW 7 4482975 nonsense probably null
R2170:Ppp1r12c UTSW 7 4482806 missense possibly damaging 0.76
R3787:Ppp1r12c UTSW 7 4486584 missense probably damaging 1.00
R3833:Ppp1r12c UTSW 7 4482786 unclassified probably benign
R4093:Ppp1r12c UTSW 7 4483367 missense probably damaging 0.99
R4095:Ppp1r12c UTSW 7 4483367 missense probably damaging 0.99
R4108:Ppp1r12c UTSW 7 4486566 missense probably damaging 1.00
R5177:Ppp1r12c UTSW 7 4484496 nonsense probably null
R5319:Ppp1r12c UTSW 7 4483984 missense probably benign 0.01
R5561:Ppp1r12c UTSW 7 4486356 critical splice donor site probably null
R5739:Ppp1r12c UTSW 7 4497282 missense probably damaging 1.00
R5837:Ppp1r12c UTSW 7 4497404 intron probably benign
R6531:Ppp1r12c UTSW 7 4482789 critical splice donor site probably null
R7207:Ppp1r12c UTSW 7 4489868 missense probably damaging 1.00
R7507:Ppp1r12c UTSW 7 4483971 missense probably benign 0.01
R7920:Ppp1r12c UTSW 7 4483355 missense probably benign 0.00
R7934:Ppp1r12c UTSW 7 4485417 nonsense probably null
R8391:Ppp1r12c UTSW 7 4497432 missense probably damaging 1.00
R8397:Ppp1r12c UTSW 7 4489769 missense probably damaging 0.98
Z1177:Ppp1r12c UTSW 7 4484629 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACGGAAGTAAGCGATGCTGC -3'
(R):5'- GTGACGTCAATATACCGAGCGG -3'

Sequencing Primer
(F):5'- TGACAGCACGAATGACAG -3'
(R):5'- TCGCTCGCTCGCTTAGTAGG -3'
Posted On2019-06-07