Incidental Mutation 'PIT4418001:Il4ra'
ID555587
Institutional Source Beutler Lab
Gene Symbol Il4ra
Ensembl Gene ENSMUSG00000030748
Gene Nameinterleukin 4 receptor, alpha
SynonymsIl4r, IL-4 receptor alpha chain, CD124
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #PIT4418001 (G1)
Quality Score152.008
Status Not validated
Chromosome7
Chromosomal Location125552120-125579474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125576338 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 573 (G573S)
Ref Sequence ENSEMBL: ENSMUSP00000033004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033004] [ENSMUST00000206846]
Predicted Effect probably benign
Transcript: ENSMUST00000033004
AA Change: G573S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033004
Gene: ENSMUSG00000030748
AA Change: G573S

DomainStartEndE-ValueType
Pfam:IL4Ra_N 28 122 9.9e-39 PFAM
FN3 124 211 3.14e0 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206846
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Nullizygous mice exhibit reduced T helper 2 cell response to N. brasiliensis infection. Homozygotes for a null allele also display severe susceptibility to S. mansoni infection, enhanced carcinogen-induced intestinal tumour initiation, and altered control of chronic Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Il4ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Il4ra APN 7 125569175 critical splice donor site probably null
IGL01067:Il4ra APN 7 125575161 missense probably benign 0.09
IGL01107:Il4ra APN 7 125575914 missense possibly damaging 0.88
IGL02224:Il4ra APN 7 125570099 splice site probably benign
IGL02249:Il4ra APN 7 125567224 missense probably benign 0.01
IGL02383:Il4ra APN 7 125571504 missense probably benign 0.06
IGL02614:Il4ra APN 7 125575790 nonsense probably null
IGL02879:Il4ra APN 7 125576897 missense possibly damaging 0.88
Haile UTSW 7 125574717 critical splice donor site probably null
Lowe UTSW 7 125567221 missense probably damaging 1.00
BB006:Il4ra UTSW 7 125575176 missense probably benign 0.00
BB016:Il4ra UTSW 7 125575176 missense probably benign 0.00
IGL02991:Il4ra UTSW 7 125575661 missense possibly damaging 0.70
R0066:Il4ra UTSW 7 125576231 missense possibly damaging 0.80
R0127:Il4ra UTSW 7 125569070 missense probably damaging 1.00
R0148:Il4ra UTSW 7 125575537 missense probably damaging 1.00
R0238:Il4ra UTSW 7 125575199 splice site probably benign
R0239:Il4ra UTSW 7 125575199 splice site probably benign
R0884:Il4ra UTSW 7 125574663 missense probably damaging 1.00
R1102:Il4ra UTSW 7 125574717 critical splice donor site probably null
R1622:Il4ra UTSW 7 125570053 missense possibly damaging 0.87
R1773:Il4ra UTSW 7 125567182 missense possibly damaging 0.94
R4510:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4511:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4612:Il4ra UTSW 7 125576083 missense probably benign 0.14
R5865:Il4ra UTSW 7 125575176 missense probably benign 0.00
R5996:Il4ra UTSW 7 125567221 missense probably damaging 1.00
R6057:Il4ra UTSW 7 125571563 missense probably damaging 1.00
R6246:Il4ra UTSW 7 125576405 missense probably benign 0.00
R7218:Il4ra UTSW 7 125575778 missense probably benign 0.01
R7624:Il4ra UTSW 7 125569108 missense probably damaging 1.00
R7904:Il4ra UTSW 7 125565673 missense probably benign 0.05
R7929:Il4ra UTSW 7 125575176 missense probably benign 0.00
R8360:Il4ra UTSW 7 125569966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTAGTGACTGCTGTAGCCC -3'
(R):5'- ATTCTGGAAGGGCTTGTAGC -3'

Sequencing Primer
(F):5'- AAATCCTGGAGAGCTGGCTC -3'
(R):5'- GTAGCCTCCATGCCCATCG -3'
Posted On2019-06-07