Incidental Mutation 'PIT4418001:Ing2'
ID555589
Institutional Source Beutler Lab
Gene Symbol Ing2
Ensembl Gene ENSMUSG00000063049
Gene Nameinhibitor of growth family, member 2
SynonymsIng1l, P33ING2, 2810011M06Rik, ING2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location47667178-47675556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47669090 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 141 (M141K)
Ref Sequence ENSEMBL: ENSMUSP00000079226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080353]
PDB Structure
Solution structure of PHD domain in inhibitor of growth family, member 1-like [SOLUTION NMR]
Crystal structure of ING2 PHD finger in complex with H3K4Me3 peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000080353
AA Change: M141K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079226
Gene: ENSMUSG00000063049
AA Change: M141K

DomainStartEndE-ValueType
Pfam:ING 28 126 2e-26 PFAM
low complexity region 143 162 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
PHD 215 260 5.1e-15 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes impaired spermatogenesis and male infertility associated with teratozoospermia, seminiferous tubule degeneration, germ cell depletion, arrest of male meiosis and enhanced testicular apoptosis, and leads to an increased incidence of soft tissue sarcomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Ing2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Ing2 APN 8 47669261 missense possibly damaging 0.92
IGL01791:Ing2 APN 8 47669035 missense probably benign 0.02
IGL02477:Ing2 APN 8 47669268 missense possibly damaging 0.95
R0315:Ing2 UTSW 8 47669090 missense probably benign 0.06
R1793:Ing2 UTSW 8 47669329 missense probably damaging 1.00
R5521:Ing2 UTSW 8 47669213 missense probably damaging 1.00
R5759:Ing2 UTSW 8 47669005 missense possibly damaging 0.71
R5821:Ing2 UTSW 8 47668826 missense probably benign 0.32
R6222:Ing2 UTSW 8 47668931 missense possibly damaging 0.95
R6378:Ing2 UTSW 8 47669258 missense probably benign 0.32
R7031:Ing2 UTSW 8 47668823 missense probably benign 0.31
R7243:Ing2 UTSW 8 47674539 missense probably damaging 0.98
R7819:Ing2 UTSW 8 47669028 missense probably damaging 1.00
X0036:Ing2 UTSW 8 47674507 missense probably null 0.94
Predicted Primers PCR Primer
(F):5'- AGCAGTAGGTGGGCTCATTG -3'
(R):5'- TACAGCAGCATCTCCAGAGAGC -3'

Sequencing Primer
(F):5'- CTCATTGGGATCGATGGCAAACTC -3'
(R):5'- GCATCTCCAGAGAGCGTTAATC -3'
Posted On2019-06-07