Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4418001:Myo9b'

555591

Institutional Source

Beutler Lab

Gene Symbol

Myo9b

Ensembl Gene

ENSMUSG00000004677

Gene Name

myosin IXb

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.758) question?

Stock #

PIT4418001 (G1)

Quality Score

204.009

Status

Not validated

Chromosome

Chromosomal Location

71272714-71360713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 71322947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 338 (F338V)

Ref Sequence

ENSEMBL: ENSMUSP00000129220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071935
AA Change: F338V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: F338V

Domain	Start	End	E-Value	Type
RA	15	114	3.7e-30	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	1.2e-3	SMART
IQ	978	1000	1.6e-5	SMART
IQ	1001	1022	4.3e-5	SMART
IQ	1023	1045	8.4e-5	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1232	1246	N/A	INTRINSIC
Blast:MYSc	1247	1323	3e-19	BLAST
low complexity region	1348	1359	N/A	INTRINSIC
coiled coil region	1563	1590	N/A	INTRINSIC
C1	1591	1639	1.7e-14	SMART
RhoGAP	1668	1843	4.7e-71	SMART
coiled coil region	1901	1925	N/A	INTRINSIC
low complexity region	1940	1952	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168839
AA Change: F338V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: F338V

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1915	1939	N/A	INTRINSIC
low complexity region	1954	1966	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170242
AA Change: F338V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: F338V

Domain	Start	End	E-Value	Type
RA	15	114	5.79e-28	SMART
MYSc	140	954	N/A	SMART
IQ	955	977	2.46e-1	SMART
IQ	978	1000	3.35e-3	SMART
IQ	1001	1022	8.84e-3	SMART
IQ	1023	1045	1.77e-2	SMART
low complexity region	1050	1064	N/A	INTRINSIC
low complexity region	1127	1145	N/A	INTRINSIC
low complexity region	1211	1222	N/A	INTRINSIC
low complexity region	1234	1257	N/A	INTRINSIC
Blast:MYSc	1258	1334	3e-19	BLAST
low complexity region	1361	1372	N/A	INTRINSIC
low complexity region	1581	1601	N/A	INTRINSIC
C1	1605	1653	3.58e-12	SMART
RhoGAP	1682	1857	7.78e-69	SMART
coiled coil region	1931	1955	N/A	INTRINSIC
low complexity region	1970	1982	N/A	INTRINSIC
low complexity region	1992	2003	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212935
AA Change: F338V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 93.3%
3x: 90.8%
10x: 84.7%
20x: 71.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb1	T	C	6: 88,839,648	Y100C	possibly damaging	Het
Adamtsl1	T	C	4: 86,243,724	Y365H	probably damaging	Het
Atad2b	A	T	12: 5,024,587	I1049F	probably benign	Het
Atg9b	A	T	5: 24,385,515	S859T	possibly damaging	Het
Banp	G	A	8: 122,005,626	A380T	probably damaging	Het
Brinp3	C	T	1: 146,901,423	T536I	probably damaging	Het
Cacna1c	T	C	6: 118,654,423	E1155G		Het
Capn12	T	C	7: 28,886,536	S270P	probably benign	Het
Cbs	A	T	17: 31,615,521	I498N	possibly damaging	Het
Ccdc129	T	G	6: 55,968,345	S684A	probably damaging	Het
Cep68	T	C	11: 20,239,731	K427R	probably benign	Het
Cobl	G	A	11: 12,256,240	T545I	possibly damaging	Het
Cr2	T	A	1: 195,157,452	M556L	probably benign	Het
Crebbp	A	G	16: 4,114,825	S1068P	probably benign	Het
D2hgdh	C	T	1: 93,838,868	H385Y	possibly damaging	Het
Dennd1b	T	C	1: 139,081,261	L159P		Het
Dnajb4	A	T	3: 152,193,497	F31I	possibly damaging	Het
Dnajc16	A	G	4: 141,770,949	F369S	probably damaging	Het
Dtl	A	T	1: 191,541,317	L493H	possibly damaging	Het
Efcab5	T	A	11: 77,132,051	Q612L	possibly damaging	Het
Efr3b	A	T	12: 3,980,490	L407Q	possibly damaging	Het
Ehbp1	T	A	11: 22,053,494	Q1085L	probably damaging	Het
Ell	T	C	8: 70,581,681	V199A	probably damaging	Het
Elmod2	G	T	8: 83,321,542	T97K	probably benign	Het
Epn3	T	C	11: 94,496,130	E138G	probably damaging	Het
Esf1	A	T	2: 140,159,777	F383L	probably benign	Het
Fam193a	A	T	5: 34,440,535	T559S	probably damaging	Het
Galr2	T	C	11: 116,283,258	V238A	probably benign	Het
Gm3476	T	C	14: 6,118,411	I237M	probably benign	Het
Gm5160	A	T	18: 14,425,282	I139F	probably damaging	Het
Gpr15	T	C	16: 58,717,950	T259A	probably benign	Het
Iffo1	A	G	6: 125,149,783	K293E	possibly damaging	Het
Ikbip	T	A	10: 91,096,533	H346Q	probably benign	Het
Il4ra	G	A	7: 125,576,338	G573S	probably benign	Het
Ing2	A	T	8: 47,669,090	M141K	probably benign	Het
Itga6	T	C	2: 71,834,070	S517P	probably benign	Het
Kcnab1	A	G	3: 65,358,320	E295G	probably benign	Het
Klhl21	A	C	4: 152,015,378	Y515S	possibly damaging	Het
Lcn9	A	T	2: 25,824,541	Y139F	probably damaging	Het
Mcemp1	G	T	8: 3,667,052	L64F	probably null	Het
Mos	T	C	4: 3,870,814	D334G	possibly damaging	Het
Nefl	G	A	14: 68,086,530	V406M	probably damaging	Het
Nfam1	C	A	15: 83,001,488	R181L	probably damaging	Het
Ntn5	A	G	7: 45,686,501	R119G	probably damaging	Het
Olfr1145	G	T	2: 87,810,594	C258F	probably damaging	Het
Olfr1453	A	T	19: 13,027,731	Y199*	probably null	Het
Olfr19	T	C	16: 16,673,855	N42S	probably damaging	Het
Plch2	A	T	4: 154,989,503	V914E	probably damaging	Het
Ppp1r12c	T	C	7: 4,501,267	Q111R	probably null	Het
Ptchd3	T	A	11: 121,841,740	Y485*	probably null	Het
Ptchd4	T	A	17: 42,503,089	I627N	probably damaging	Het
Retnlb	T	C	16: 48,817,268	V19A	probably benign	Het
Rimbp2	T	A	5: 128,780,361	T809S	probably benign	Het
Sema6c	T	A	3: 95,170,090	D404E	possibly damaging	Het
Slc22a16	C	T	10: 40,603,825	A631V	unknown	Het
Snai3	A	T	8: 122,456,334	H157Q	probably benign	Het
Snx15	T	C	19: 6,123,931	Y52C	probably damaging	Het
Strbp	T	C	2: 37,645,492	E68G	probably benign	Het
Sun1	T	A	5: 139,226,588	D155E	probably damaging	Het
Susd2	T	C	10: 75,638,349	D627G	probably benign	Het
Tas2r108	T	A	6: 40,493,680	I30K	probably damaging	Het
Tmc2	T	C	2: 130,248,651	V639A	probably damaging	Het
Trmt1	T	C	8: 84,697,670	Y445H	probably damaging	Het
Ttn	A	T	2: 76,767,210	N19786K	probably damaging	Het
Vmn1r79	T	G	7: 12,176,839	V216G	probably damaging	Het
Wdr64	C	A	1: 175,743,594	Y331*	probably null	Het
Zfyve28	A	T	5: 34,233,377	V180E	probably damaging	Het
Zic4	C	T	9: 91,379,394	T234I	possibly damaging	Het

Other mutations in Myo9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Myo9b	APN	8	71348735	missense	probably benign
IGL01020:Myo9b	APN	8	71352000	missense	probably benign
IGL01479:Myo9b	APN	8	71359342	missense	probably damaging	1.00
IGL01704:Myo9b	APN	8	71359642	missense	probably damaging	0.98
IGL01761:Myo9b	APN	8	71349152	missense	probably damaging	0.96
IGL01766:Myo9b	APN	8	71290517	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71356318	missense	probably damaging	1.00
IGL01834:Myo9b	APN	8	71355257	missense	possibly damaging	0.93
IGL01838:Myo9b	APN	8	71334390	missense	probably damaging	0.99
IGL02318:Myo9b	APN	8	71354124	missense	probably damaging	0.98
IGL02333:Myo9b	APN	8	71358993	missense	possibly damaging	0.65
IGL02340:Myo9b	APN	8	71291045	missense	probably damaging	1.00
IGL02514:Myo9b	APN	8	71291006	missense	probably damaging	1.00
IGL02593:Myo9b	APN	8	71290773	missense	probably damaging	1.00
IGL03075:Myo9b	APN	8	71354527	missense	probably damaging	1.00
IGL03332:Myo9b	APN	8	71348774	missense	possibly damaging	0.78
avantgarde	UTSW	8	71344162	missense	probably damaging	1.00
Freaky	UTSW	8	71290819	missense	probably damaging	1.00
iconoclastic	UTSW	8	71290475	missense	probably benign	0.37
unconventional	UTSW	8	71348597	missense	probably benign	0.00
PIT4651001:Myo9b	UTSW	8	71342812	missense	possibly damaging	0.83
R0023:Myo9b	UTSW	8	71333768	missense	probably damaging	1.00
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0103:Myo9b	UTSW	8	71323849	splice site	probably benign
R0144:Myo9b	UTSW	8	71346043	missense	probably damaging	1.00
R0207:Myo9b	UTSW	8	71355225	splice site	probably benign
R0226:Myo9b	UTSW	8	71353832	missense	probably damaging	1.00
R0227:Myo9b	UTSW	8	71344162	missense	probably damaging	1.00
R0244:Myo9b	UTSW	8	71321813	missense	probably damaging	1.00
R0277:Myo9b	UTSW	8	71355952	splice site	probably benign
R0362:Myo9b	UTSW	8	71347770	missense	probably damaging	1.00
R0689:Myo9b	UTSW	8	71330756	missense	probably damaging	1.00
R0844:Myo9b	UTSW	8	71290475	missense	probably benign	0.37
R1051:Myo9b	UTSW	8	71355822	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1469:Myo9b	UTSW	8	71291036	missense	probably damaging	1.00
R1526:Myo9b	UTSW	8	71355764	missense	probably damaging	1.00
R1544:Myo9b	UTSW	8	71290976	missense	probably damaging	1.00
R1565:Myo9b	UTSW	8	71315192	missense	possibly damaging	0.46
R1645:Myo9b	UTSW	8	71322978	missense	probably damaging	1.00
R1745:Myo9b	UTSW	8	71354047	missense	probably damaging	1.00
R1820:Myo9b	UTSW	8	71333358	missense	probably damaging	1.00
R2037:Myo9b	UTSW	8	71290866	missense	probably damaging	1.00
R2050:Myo9b	UTSW	8	71290550	missense	probably damaging	1.00
R2056:Myo9b	UTSW	8	71359690	missense	possibly damaging	0.78
R2129:Myo9b	UTSW	8	71333699	missense	probably damaging	1.00
R2423:Myo9b	UTSW	8	71327940	missense	probably damaging	1.00
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2869:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2871:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2872:Myo9b	UTSW	8	71290966	missense	probably benign	0.01
R2873:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2874:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2920:Myo9b	UTSW	8	71325857	missense	probably damaging	0.98
R2926:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2939:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R2940:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3033:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3040:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3689:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3691:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R3735:Myo9b	UTSW	8	71348597	missense	probably benign	0.00
R4194:Myo9b	UTSW	8	71359624	missense	possibly damaging	0.71
R4258:Myo9b	UTSW	8	71355765	missense	probably damaging	1.00
R4457:Myo9b	UTSW	8	71290999	missense	probably damaging	1.00
R4478:Myo9b	UTSW	8	71291081	missense	probably damaging	1.00
R4496:Myo9b	UTSW	8	71334337	missense	probably benign	0.01
R4544:Myo9b	UTSW	8	71327941	missense	probably damaging	1.00
R4580:Myo9b	UTSW	8	71315135	missense	probably damaging	1.00
R4736:Myo9b	UTSW	8	71356592	missense	probably damaging	1.00
R5068:Myo9b	UTSW	8	71349055	missense	probably damaging	1.00
R5124:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
R5194:Myo9b	UTSW	8	71349089	missense	probably benign	0.01
R5296:Myo9b	UTSW	8	71333388	missense	possibly damaging	0.69
R5528:Myo9b	UTSW	8	71323274	missense	probably benign	0.06
R5664:Myo9b	UTSW	8	71359882	missense	probably benign	0.13
R5677:Myo9b	UTSW	8	71343686	missense	probably damaging	1.00
R5680:Myo9b	UTSW	8	71290372	missense	probably benign	0.00
R5982:Myo9b	UTSW	8	71348396	missense	probably benign	0.05
R6344:Myo9b	UTSW	8	71327914	missense	probably damaging	1.00
R6352:Myo9b	UTSW	8	71348410	missense	probably benign	0.16
R6352:Myo9b	UTSW	8	71348411	missense	probably benign
R6411:Myo9b	UTSW	8	71322955	nonsense	probably null
R6425:Myo9b	UTSW	8	71333628	missense	probably damaging	1.00
R6505:Myo9b	UTSW	8	71355857	missense	possibly damaging	0.88
R6743:Myo9b	UTSW	8	71352159	splice site	probably null
R6811:Myo9b	UTSW	8	71356578	missense	probably damaging	1.00
R6813:Myo9b	UTSW	8	71323305	missense	probably damaging	1.00
R6954:Myo9b	UTSW	8	71290819	missense	probably damaging	1.00
R7124:Myo9b	UTSW	8	71333701	nonsense	probably null
R7255:Myo9b	UTSW	8	71290891	missense	probably damaging	1.00
R7293:Myo9b	UTSW	8	71325905	missense	probably benign	0.00
R7342:Myo9b	UTSW	8	71355774	missense	probably damaging	1.00
R7451:Myo9b	UTSW	8	71352188	missense	probably benign	0.28
R7482:Myo9b	UTSW	8	71342798	missense	probably benign	0.00
R7508:Myo9b	UTSW	8	71354801	missense	probably benign	0.00
R7957:Myo9b	UTSW	8	71354761	missense	probably benign	0.12
R8062:Myo9b	UTSW	8	71321813	missense	probably damaging	0.99
R8108:Myo9b	UTSW	8	71348342	missense	probably damaging	0.99
R8197:Myo9b	UTSW	8	71290963	missense	probably damaging	1.00
R8274:Myo9b	UTSW	8	71359836	missense	probably benign	0.00
R8686:Myo9b	UTSW	8	71334322	missense	probably benign	0.01
R8731:Myo9b	UTSW	8	71353842	critical splice donor site	probably null
R8924:Myo9b	UTSW	8	71349031	missense	probably benign
R9056:Myo9b	UTSW	8	71352262	missense	probably benign	0.17
R9117:Myo9b	UTSW	8	71347807	missense	probably benign	0.03
R9151:Myo9b	UTSW	8	71355227	splice site	probably benign
R9315:Myo9b	UTSW	8	71349167	missense	possibly damaging	0.54
R9332:Myo9b	UTSW	8	71359602	missense	probably benign	0.07
R9364:Myo9b	UTSW	8	71355839	missense	probably damaging	1.00
R9569:Myo9b	UTSW	8	71358985	missense	probably benign
R9581:Myo9b	UTSW	8	71359899	missense	probably benign	0.19
R9600:Myo9b	UTSW	8	71290431	missense	possibly damaging	0.80
X0066:Myo9b	UTSW	8	71323898	missense	probably damaging	1.00
Z1177:Myo9b	UTSW	8	71290709	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGAGAAGTTCCCACTTTCTAAC -3'
(R):5'- AATGAATGGCTGCCTTTGTG -3'

Sequencing Primer
(F):5'- AAGACAGGGTCTCTCTGTATAGCC -3'
(R):5'- CCTTTGTGTGTGTGTGCTCAG -3'

Posted On

2019-06-07