Incidental Mutation 'PIT4418001:Trmt1'
ID555593
Institutional Source Beutler Lab
Gene Symbol Trmt1
Ensembl Gene ENSMUSG00000001909
Gene NametRNA methyltransferase 1
SynonymsD8Ertd812e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84686307-84699808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84697670 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 445 (Y445H)
Ref Sequence ENSEMBL: ENSMUSP00000001974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000037165] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370] [ENSMUST00000131700] [ENSMUST00000143427] [ENSMUST00000152301] [ENSMUST00000175784] [ENSMUST00000177084] [ENSMUST00000177423]
Predicted Effect probably damaging
Transcript: ENSMUST00000001974
AA Change: Y445H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909
AA Change: Y445H

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037165
SMART Domains Protein: ENSMUSP00000046010
Gene: ENSMUSG00000034041

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
HLH 155 207 3.97e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109767
AA Change: Y445H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909
AA Change: Y445H

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109768
AA Change: Y438H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909
AA Change: Y438H

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125370
AA Change: Y416H

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909
AA Change: Y416H

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131700
SMART Domains Protein: ENSMUSP00000122526
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 108 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136423
SMART Domains Protein: ENSMUSP00000134723
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143427
SMART Domains Protein: ENSMUSP00000117140
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 47 98 3.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152301
SMART Domains Protein: ENSMUSP00000116712
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 242 4.2e-49 PFAM
Pfam:Met_10 145 229 2.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175784
SMART Domains Protein: ENSMUSP00000135273
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 54 221 8.6e-39 PFAM
Pfam:Met_10 144 221 5.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175884
Predicted Effect probably benign
Transcript: ENSMUST00000177084
SMART Domains Protein: ENSMUSP00000135675
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 29 260 4.1e-76 PFAM
Pfam:Met_10 117 231 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177423
SMART Domains Protein: ENSMUSP00000135327
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 47 262 1.4e-66 PFAM
Pfam:Met_10 138 252 5.6e-9 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Trmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Trmt1 APN 8 84695509 missense possibly damaging 0.92
IGL01959:Trmt1 APN 8 84691376 splice site probably null
IGL02127:Trmt1 APN 8 84697471 missense probably damaging 1.00
IGL02689:Trmt1 APN 8 84699756 unclassified probably benign
IGL03087:Trmt1 APN 8 84695233 missense probably damaging 1.00
IGL02835:Trmt1 UTSW 8 84696960 missense probably null 1.00
R0395:Trmt1 UTSW 8 84697112 splice site probably null
R0964:Trmt1 UTSW 8 84696852 missense probably damaging 1.00
R1881:Trmt1 UTSW 8 84689267 intron probably benign
R2190:Trmt1 UTSW 8 84689841 nonsense probably null
R2197:Trmt1 UTSW 8 84690858 missense probably damaging 1.00
R2979:Trmt1 UTSW 8 84696882 missense probably damaging 1.00
R3813:Trmt1 UTSW 8 84695217 unclassified probably benign
R4407:Trmt1 UTSW 8 84697755 unclassified probably benign
R4461:Trmt1 UTSW 8 84699149 missense probably benign 0.01
R4588:Trmt1 UTSW 8 84690753 intron probably benign
R5170:Trmt1 UTSW 8 84695232 missense probably damaging 1.00
R6299:Trmt1 UTSW 8 84697290 nonsense probably null
R6614:Trmt1 UTSW 8 84689333 missense probably benign
R6666:Trmt1 UTSW 8 84698454 missense probably damaging 1.00
R7669:Trmt1 UTSW 8 84697551 missense probably benign 0.05
R7952:Trmt1 UTSW 8 84689340 missense possibly damaging 0.50
Z1176:Trmt1 UTSW 8 84698240 missense possibly damaging 0.95
Z1176:Trmt1 UTSW 8 84699198 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGACCTGGACTTTGTGGGC -3'
(R):5'- TGACGTCAAAGCTACCTGCC -3'

Sequencing Primer
(F):5'- GCAGTGACCACGAATCCTG -3'
(R):5'- AGTTCTAGGGAAGCTGACACCTTC -3'
Posted On2019-06-07