Incidental Mutation 'PIT4418001:Ehbp1'
ID555602
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene NameEH domain binding protein 1
SynonymsKIAA0903-like, Flj21950
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.521) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location22005828-22342292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22053494 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1085 (Q1085L)
Ref Sequence ENSEMBL: ENSMUSP00000105191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000180360]
Predicted Effect probably damaging
Transcript: ENSMUST00000045167
AA Change: Q1060L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302
AA Change: Q1060L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109563
AA Change: Q1085L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: Q1085L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180360
AA Change: Q1060L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302
AA Change: Q1060L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22247967 splice site probably benign
IGL00786:Ehbp1 APN 11 22100460 missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22138022 missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22089636 missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22095611 missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22172883 missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22089584 missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22101115 missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22101218 missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22285486 critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22096048 missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22089653 missense probably damaging 1.00
trajan UTSW 11 22151850 missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22089683 splice site probably benign
R0218:Ehbp1 UTSW 11 22231992 splice site probably benign
R0294:Ehbp1 UTSW 11 22095427 missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22095886 missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22151836 missense probably benign
R0468:Ehbp1 UTSW 11 22169184 splice site probably benign
R0943:Ehbp1 UTSW 11 22095883 missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22062831 missense probably benign 0.25
R1481:Ehbp1 UTSW 11 22006782 makesense probably null
R1493:Ehbp1 UTSW 11 22006866 missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22059231 missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22096000 missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22146694 missense probably benign
R1696:Ehbp1 UTSW 11 22053441 missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22151850 missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22059228 missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22095462 missense probably benign
R2436:Ehbp1 UTSW 11 22089524 critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22100465 missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22137867 missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22285498 missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22095898 missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22151843 missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22095892 missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22101164 missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22146592 missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22239169 missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22101073 missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22095370 missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22137846 missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22151887 missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22239156 missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22285684 start gained probably benign
R6685:Ehbp1 UTSW 11 22146641 missense probably benign 0.01
R6893:Ehbp1 UTSW 11 22014945 missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22053529 nonsense probably null
R7465:Ehbp1 UTSW 11 22138001 missense probably benign
R7722:Ehbp1 UTSW 11 22089572 missense probably null
R7724:Ehbp1 UTSW 11 22089572 missense probably null
R7797:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22146542 nonsense probably null
R8088:Ehbp1 UTSW 11 22089572 missense probably null
R8218:Ehbp1 UTSW 11 22096096 missense possibly damaging 0.77
R8235:Ehbp1 UTSW 11 22239153 missense probably damaging 1.00
R8267:Ehbp1 UTSW 11 22146562 missense probably benign 0.02
R8318:Ehbp1 UTSW 11 22137980 missense probably benign 0.05
R8334:Ehbp1 UTSW 11 22007170 missense probably damaging 1.00
R8425:Ehbp1 UTSW 11 22013495 missense probably damaging 1.00
R8439:Ehbp1 UTSW 11 22096109 missense possibly damaging 0.79
RF016:Ehbp1 UTSW 11 22146646 missense probably benign
RF037:Ehbp1 UTSW 11 22006783 small deletion probably benign
X0018:Ehbp1 UTSW 11 22101085 missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22095590 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGCGCTCTTATCACCAGG -3'
(R):5'- CTAAGGCTGAGGCTAAGTGTATG -3'

Sequencing Primer
(F):5'- TTATCACCAGGGCCCAGAGAG -3'
(R):5'- AGGCTAAGTGTATGTTTGCTTCTC -3'
Posted On2019-06-07