Incidental Mutation 'PIT4418001:Galr2'
ID 555605
Institutional Source Beutler Lab
Gene Symbol Galr2
Ensembl Gene ENSMUSG00000020793
Gene Name galanin receptor 2
Synonyms mGalR, GalR2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # PIT4418001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 116280939-116283938 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116283258 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 238 (V238A)
Ref Sequence ENSEMBL: ENSMUSP00000054062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000055872] [ENSMUST00000106411] [ENSMUST00000106413]
AlphaFold O88854
Predicted Effect probably benign
Transcript: ENSMUST00000021147
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055872
AA Change: V238A

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054062
Gene: ENSMUSG00000020793
AA Change: V238A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 306 4.1e-12 PFAM
Pfam:7tm_1 41 291 6.4e-52 PFAM
Pfam:7TM_GPCR_Srv 62 307 1.2e-7 PFAM
Pfam:7TM_GPCR_Srw 184 308 4.7e-8 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106411
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106413
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Galanin is an important neuromodulator present in the brain, gastrointestinal system, and hypothalamopituitary axis. It is a 30-amino acid non-C-terminally amidated peptide that potently stimulates growth hormone secretion, inhibits cardiac vagal slowing of heart rate, abolishes sinus arrhythmia, and inhibits postprandial gastrointestinal motility. The actions of galanin are mediated through interaction with specific membrane receptors that are members of the 7-transmembrane family of G protein-coupled receptors. GALR2 interacts with the N-terminal residues of the galanin peptide. The primary signaling mechanism for GALR2 is through the phospholipase C/protein kinase C pathway (via Gq), in contrast to GALR1, which communicates its intracellular signal by inhibition of adenylyl cyclase through Gi. However, it has been demonstrated that GALR2 couples efficiently to both the Gq and Gi proteins to simultaneously activate 2 independent signal transduction pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduction in exploratory activity. There is also a modest shift in the distribution of different lymphocyte cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Galr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Galr2 APN 11 116283170 missense probably damaging 1.00
PIT4445001:Galr2 UTSW 11 116281648 missense probably benign 0.13
R0426:Galr2 UTSW 11 116281691 missense probably damaging 1.00
R1869:Galr2 UTSW 11 116283243 missense possibly damaging 0.87
R2059:Galr2 UTSW 11 116282939 missense probably damaging 1.00
R4579:Galr2 UTSW 11 116281499 missense probably benign
R4666:Galr2 UTSW 11 116283629 missense probably benign
R5832:Galr2 UTSW 11 116281631 missense probably damaging 1.00
R5974:Galr2 UTSW 11 116283026 missense possibly damaging 0.62
R7081:Galr2 UTSW 11 116283048 missense probably damaging 0.99
R7155:Galr2 UTSW 11 116283582 missense possibly damaging 0.94
R7696:Galr2 UTSW 11 116283167 missense probably damaging 1.00
R7810:Galr2 UTSW 11 116283120 missense probably benign 0.23
R8921:Galr2 UTSW 11 116283147 missense probably damaging 1.00
R9231:Galr2 UTSW 11 116283509 missense probably benign
R9514:Galr2 UTSW 11 116283626 missense probably benign
X0009:Galr2 UTSW 11 116283323 missense probably benign 0.14
X0026:Galr2 UTSW 11 116281751 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTACAGTCAGTCGCAGCTG -3'
(R):5'- CTTGGAGACCAGAGCATAAACG -3'

Sequencing Primer
(F):5'- AATCTGACGGTGTGCCAC -3'
(R):5'- CATAAACGATGGGGTTGACACAC -3'
Posted On 2019-06-07