Incidental Mutation 'PIT4418001:Atad2b'
ID 555608
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4418001 (G1)
Quality Score 211.009
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5024587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1049 (I1049F)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably benign
Transcript: ENSMUST00000045664
AA Change: I1049F

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: I1049F

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
R9450:Atad2b UTSW 12 5013859 missense probably benign 0.06
R9453:Atad2b UTSW 12 5031578 missense probably benign 0.13
R9494:Atad2b UTSW 12 5031852 missense probably benign 0.26
R9634:Atad2b UTSW 12 5010332 missense probably damaging 1.00
R9764:Atad2b UTSW 12 5032064 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTCTGGGGCACATAGTG -3'
(R):5'- GCTATGAAACACAGAAGGCTTTG -3'

Sequencing Primer
(F):5'- ACTCTGGGGCACATAGTGACTATC -3'
(R):5'- CAGAAGGCTTTGGTCGCATAGC -3'
Posted On 2019-06-07