Incidental Mutation 'PIT4418001:Nefl'
ID555610
Institutional Source Beutler Lab
Gene Symbol Nefl
Ensembl Gene ENSMUSG00000022055
Gene Nameneurofilament, light polypeptide
SynonymsNfl, CMT2E, NF68, NF-L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4418001 (G1)
Quality Score180.009
Status Not validated
Chromosome14
Chromosomal Location68083863-68089095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68086530 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 406 (V406M)
Ref Sequence ENSEMBL: ENSMUSP00000022639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022639] [ENSMUST00000111089]
Predicted Effect probably damaging
Transcript: ENSMUST00000022639
AA Change: V406M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022639
Gene: ENSMUSG00000022055
AA Change: V406M

DomainStartEndE-ValueType
Pfam:Filament_head 9 88 7e-14 PFAM
Filament 89 400 6.93e-139 SMART
low complexity region 448 470 N/A INTRINSIC
coiled coil region 473 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111089
SMART Domains Protein: ENSMUSP00000106718
Gene: ENSMUSG00000022054

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 1.6e-16 PFAM
Pfam:Filament 98 403 1.1e-104 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the light chain neurofilament protein. Mutations in this gene cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E), disorders of the peripheral nervous system that are characterized by distinct neuropathies. A pseudogene has been identified on chromosome Y. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene lack neurofilaments in their axons and have motor axons that are reduced in both size and number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Nefl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Nefl APN 14 68086482 intron probably benign
IGL01755:Nefl APN 14 68086077 missense probably damaging 1.00
IGL02825:Nefl APN 14 68084346 missense possibly damaging 0.96
IGL03297:Nefl APN 14 68084224 missense possibly damaging 0.55
R0503:Nefl UTSW 14 68083983 missense probably benign 0.08
R1837:Nefl UTSW 14 68086626 missense probably damaging 1.00
R1970:Nefl UTSW 14 68086672 missense probably benign 0.20
R4812:Nefl UTSW 14 68084285 missense probably damaging 1.00
R4972:Nefl UTSW 14 68086763 intron probably benign
R5361:Nefl UTSW 14 68084639 missense probably damaging 0.99
R6357:Nefl UTSW 14 68084318 missense probably damaging 1.00
R6499:Nefl UTSW 14 68084585 missense probably damaging 1.00
R7571:Nefl UTSW 14 68084674 missense probably benign 0.00
R8086:Nefl UTSW 14 68086031 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTAATAGGGATGCATAGAAGGTC -3'
(R):5'- TAGCCTCAATGGTCTCCTCG -3'

Sequencing Primer
(F):5'- TGGGGTCTCTCGTGAACTCC -3'
(R):5'- GACCTCTGTCTGCTCTTCCTGG -3'
Posted On2019-06-07