Incidental Mutation 'PIT4418001:Nfam1'
ID555611
Institutional Source Beutler Lab
Gene Symbol Nfam1
Ensembl Gene ENSMUSG00000058099
Gene NameNfat activating molecule with ITAM motif 1
Synonyms4921501M20Rik, Nfam1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82992973-83033306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83001488 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 181 (R181L)
Ref Sequence ENSEMBL: ENSMUSP00000105129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023076] [ENSMUST00000100377] [ENSMUST00000109503] [ENSMUST00000231165] [ENSMUST00000231204]
Predicted Effect probably damaging
Transcript: ENSMUST00000023076
AA Change: R170L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023076
Gene: ENSMUSG00000058099
AA Change: R170L

DomainStartEndE-ValueType
Blast:IG 1 94 7e-28 BLAST
transmembrane domain 108 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100377
SMART Domains Protein: ENSMUSP00000097946
Gene: ENSMUSG00000058099

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Blast:IG 49 145 3e-29 BLAST
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109503
AA Change: R181L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105129
Gene: ENSMUSG00000058099
AA Change: R181L

DomainStartEndE-ValueType
Blast:IG 22 105 3e-22 BLAST
transmembrane domain 119 141 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231165
AA Change: R221L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231204
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane receptor that activates cytokine gene promoters such as the IL-13 and TNF-alpha promoters. The encoded protein contains an immunoreceptor tyrosine-based activation motif (ITAM) and is thought to regulate the signaling and development of B-cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Nfam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Nfam1 APN 15 83022984 missense probably benign 0.16
IGL02323:Nfam1 APN 15 83022951 missense probably benign 0.00
IGL03256:Nfam1 APN 15 83010410 missense probably benign 0.25
E0374:Nfam1 UTSW 15 83016410 missense probably benign 0.02
R0403:Nfam1 UTSW 15 83016379 missense probably benign 0.12
R0463:Nfam1 UTSW 15 83001483 missense probably damaging 1.00
R0554:Nfam1 UTSW 15 83033209 missense probably benign 0.00
R0664:Nfam1 UTSW 15 83014938 missense probably damaging 1.00
R2113:Nfam1 UTSW 15 83015001 nonsense probably null
R5871:Nfam1 UTSW 15 83016422 missense probably damaging 1.00
R5982:Nfam1 UTSW 15 83033124 missense probably damaging 0.96
R7350:Nfam1 UTSW 15 83010439 missense probably benign 0.06
R7452:Nfam1 UTSW 15 83014962 missense probably benign 0.00
R8100:Nfam1 UTSW 15 83016529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGGTCCAATTCTCTGGTC -3'
(R):5'- CAGGGACTTAGGTGGCTTATGAC -3'

Sequencing Primer
(F):5'- CCATGGGTCAGAAGGTAA -3'
(R):5'- TTCCACAGCACATCAGGT -3'
Posted On2019-06-07