Incidental Mutation 'PIT4418001:Cbs'
ID555616
Institutional Source Beutler Lab
Gene Symbol Cbs
Ensembl Gene ENSMUSG00000024039
Gene Namecystathionine beta-synthase
SynonymsHIP4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location31612623-31637199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31615521 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 498 (I498N)
Ref Sequence ENSEMBL: ENSMUSP00000066878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067801] [ENSMUST00000078509] [ENSMUST00000118504]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067801
AA Change: I498N

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066878
Gene: ENSMUSG00000024039
AA Change: I498N

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.7e-66 PFAM
CBS 417 465 5.9e-11 SMART
Blast:CBS 482 553 1e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000078509
AA Change: I498N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077597
Gene: ENSMUSG00000024039
AA Change: I498N

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000118504
AA Change: I498N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113209
Gene: ENSMUSG00000024039
AA Change: I498N

DomainStartEndE-ValueType
Pfam:PALP 77 373 3.4e-64 PFAM
CBS 417 465 1.19e-8 SMART
Blast:CBS 483 539 2e-11 BLAST
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous targeted mutants are severely growth retarded and die within 5 weeks of birth with enlarged multinucleate hepatocytes filled with lipid and massively elevated plasma homocysteine levels. Heterozygotes have twice normal homocysteine levels, butsurvive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Cbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Cbs APN 17 31621514 missense possibly damaging 0.90
IGL02030:Cbs APN 17 31625489 critical splice donor site probably null
IGL02089:Cbs APN 17 31615545 missense probably benign 0.13
IGL02274:Cbs APN 17 31625948 splice site probably null
IGL02733:Cbs APN 17 31625031 missense probably benign 0.01
R0334:Cbs UTSW 17 31619156 missense probably damaging 1.00
R0398:Cbs UTSW 17 31617242 missense probably benign 0.01
R0466:Cbs UTSW 17 31616152 missense probably benign
R0732:Cbs UTSW 17 31625029 missense probably benign 0.00
R1125:Cbs UTSW 17 31632831 missense probably benign 0.00
R1586:Cbs UTSW 17 31622474 missense probably damaging 1.00
R1646:Cbs UTSW 17 31613195 missense probably benign 0.00
R1728:Cbs UTSW 17 31620949 missense probably benign 0.35
R1729:Cbs UTSW 17 31620949 missense probably benign 0.35
R1784:Cbs UTSW 17 31620949 missense probably benign 0.35
R1823:Cbs UTSW 17 31624271 missense probably damaging 1.00
R2200:Cbs UTSW 17 31624264 missense probably damaging 1.00
R3829:Cbs UTSW 17 31617381 splice site probably benign
R3892:Cbs UTSW 17 31616074 missense probably benign 0.06
R4073:Cbs UTSW 17 31633005 missense possibly damaging 0.80
R4089:Cbs UTSW 17 31633006 missense probably benign 0.03
R4799:Cbs UTSW 17 31632852 missense probably damaging 0.99
R5029:Cbs UTSW 17 31615482 missense possibly damaging 0.85
R5194:Cbs UTSW 17 31624224 splice site probably null
R5244:Cbs UTSW 17 31617160 missense probably damaging 1.00
R5660:Cbs UTSW 17 31624246 missense probably damaging 1.00
R5890:Cbs UTSW 17 31613219 missense probably damaging 0.97
R5935:Cbs UTSW 17 31632879 missense probably damaging 0.98
R5936:Cbs UTSW 17 31625094 missense probably damaging 0.98
R6891:Cbs UTSW 17 31622457 missense probably damaging 1.00
R7126:Cbs UTSW 17 31619139 missense probably benign 0.09
R7220:Cbs UTSW 17 31619217 missense probably benign 0.00
R7343:Cbs UTSW 17 31619139 missense possibly damaging 0.74
R8237:Cbs UTSW 17 31615480 missense probably benign 0.06
X0025:Cbs UTSW 17 31616137 missense possibly damaging 0.94
X0057:Cbs UTSW 17 31632970 missense probably benign 0.01
X0067:Cbs UTSW 17 31627555 missense probably damaging 1.00
Z1177:Cbs UTSW 17 31625882 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTCTTAGGGAGCATGTCTG -3'
(R):5'- ATCTCAAGCCAGTATTCAGGCAG -3'

Sequencing Primer
(F):5'- TGTACCACGAGAACCTG -3'
(R):5'- CCAGTATTCAGGCAGGTTGC -3'
Posted On2019-06-07