Incidental Mutation 'PIT4418001:Snx15'
ID555619
Institutional Source Beutler Lab
Gene Symbol Snx15
Ensembl Gene ENSMUSG00000024787
Gene Namesorting nexin 15
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4418001 (G1)
Quality Score109.008
Status Not validated
Chromosome19
Chromosomal Location6119399-6128304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6123931 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 52 (Y52C)
Ref Sequence ENSEMBL: ENSMUSP00000025702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025702] [ENSMUST00000138931] [ENSMUST00000154601]
Predicted Effect probably damaging
Transcript: ENSMUST00000025702
AA Change: Y52C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025702
Gene: ENSMUSG00000024787
AA Change: Y52C

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
MIT 265 337 7.77e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138931
AA Change: Y40C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114189
Gene: ENSMUSG00000024787
AA Change: Y40C

DomainStartEndE-ValueType
PX 8 112 1.69e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154601
AA Change: Y52C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122740
Gene: ENSMUSG00000024787
AA Change: Y52C

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
Blast:MIT 222 251 4e-12 BLAST
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Overexpression of this gene results in a decrease in the processing of insulin and hepatocyte growth factor receptors to their mature subunits. This decrease is caused by the mislocalization of furin, the endoprotease responsible for cleavage of insulin and hepatocyte growth factor receptors. This protein is involved in endosomal trafficking from the plasma membrane to recycling endosomes or the trans-Golgi network. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ADP-ribosylation factor-like 2 (ARL2) gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Sun1 T A 5: 139,226,588 D155E probably damaging Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Snx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Snx15 APN 19 6119885 missense probably benign 0.00
IGL02102:Snx15 APN 19 6122074 missense possibly damaging 0.69
R0079:Snx15 UTSW 19 6123913 missense probably damaging 1.00
R0654:Snx15 UTSW 19 6121885 missense probably benign 0.33
R1499:Snx15 UTSW 19 6122064 missense probably damaging 1.00
R1943:Snx15 UTSW 19 6128066 missense probably damaging 1.00
R2991:Snx15 UTSW 19 6121485 missense probably damaging 0.99
R3769:Snx15 UTSW 19 6123954 splice site probably benign
R5117:Snx15 UTSW 19 6124151 critical splice donor site probably null
R5763:Snx15 UTSW 19 6122110 missense probably damaging 0.99
R6219:Snx15 UTSW 19 6121508 missense probably damaging 0.99
R7024:Snx15 UTSW 19 6120596 missense probably damaging 0.98
R7297:Snx15 UTSW 19 6120507 missense probably damaging 1.00
R8139:Snx15 UTSW 19 6119915 missense probably damaging 1.00
R8139:Snx15 UTSW 19 6119916 missense probably damaging 1.00
Z1088:Snx15 UTSW 19 6121411 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTGTTCAGGGTACAACATC -3'
(R):5'- AGAAGGGCTGTTCCTGTACAC -3'

Sequencing Primer
(F):5'- TGTTCAGGGTACAACATCACACTC -3'
(R):5'- AAGGGCTGTTCCTGTACACATCAG -3'
Posted On2019-06-07