Incidental Mutation 'PIT4468001:Farp2'
ID555622
Institutional Source Beutler Lab
Gene Symbol Farp2
Ensembl Gene ENSMUSG00000034066
Gene NameFERM, RhoGEF and pleckstrin domain protein 2
SynonymsFir, D030026M03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4468001 (G1)
Quality Score195.009
Status Not validated
Chromosome1
Chromosomal Location93512079-93621976 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 93528777 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 61 (E61*)
Ref Sequence ENSEMBL: ENSMUSP00000112725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120301] [ENSMUST00000122402]
PDB Structure
Crystal strucure of the DH domain of FARP2 [X-RAY DIFFRACTION]
Crystal strucure of the DH-PH-PH domain of FARP2 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000120301
AA Change: E61*
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066
AA Change: E61*

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122402
AA Change: E61*
SMART Domains Protein: ENSMUSP00000113790
Gene: ENSMUSG00000034066
AA Change: E61*

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 690 700 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit slight increase in bone volumetrics and reduced osteoclast differentiation from BMDMs cultured with M-CSF and RANKL [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Arhgap15 C A 2: 44,243,131 Q350K probably damaging Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mib1 T C 18: 10,798,463 S775P possibly damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Ntn4 A G 10: 93,644,725 T104A probably damaging Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1030 A T 2: 85,984,448 T203S probably benign Het
Olfr1271 C A 2: 90,266,220 C70F probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Vwa8 G T 14: 79,183,061 R1734L probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Farp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Farp2 APN 1 93603381 missense probably benign 0.00
IGL00953:Farp2 APN 1 93561174 missense possibly damaging 0.92
IGL00961:Farp2 APN 1 93621313 missense possibly damaging 0.81
IGL00970:Farp2 APN 1 93560327 missense probably benign 0.00
IGL01377:Farp2 APN 1 93603459 missense possibly damaging 0.74
IGL01408:Farp2 APN 1 93618980 missense probably benign 0.19
IGL01919:Farp2 APN 1 93576433 missense probably damaging 1.00
IGL01985:Farp2 APN 1 93607602 missense probably damaging 1.00
IGL02375:Farp2 APN 1 93576463 missense probably damaging 1.00
IGL02392:Farp2 APN 1 93577650 missense probably damaging 1.00
IGL02815:Farp2 APN 1 93560285 missense probably damaging 1.00
IGL03003:Farp2 APN 1 93567418 missense probably damaging 1.00
IGL03074:Farp2 APN 1 93560327 missense probably benign 0.00
IGL03223:Farp2 APN 1 93617602 nonsense probably null
IGL03379:Farp2 APN 1 93607438 missense probably benign 0.08
IGL02802:Farp2 UTSW 1 93528610 missense probably damaging 1.00
PIT4494001:Farp2 UTSW 1 93617594 missense probably damaging 1.00
R0207:Farp2 UTSW 1 93569087 missense probably damaging 0.96
R0521:Farp2 UTSW 1 93576821 critical splice acceptor site probably null
R0594:Farp2 UTSW 1 93576500 missense probably damaging 1.00
R1386:Farp2 UTSW 1 93620151 splice site probably null
R1522:Farp2 UTSW 1 93618553 missense possibly damaging 0.79
R1589:Farp2 UTSW 1 93579860 missense probably damaging 1.00
R1651:Farp2 UTSW 1 93603469 critical splice donor site probably null
R1695:Farp2 UTSW 1 93560325 missense probably damaging 0.97
R1833:Farp2 UTSW 1 93576364 splice site probably benign
R1915:Farp2 UTSW 1 93528702 missense probably benign 0.16
R2241:Farp2 UTSW 1 93579903 missense probably benign 0.31
R4505:Farp2 UTSW 1 93619010 missense probably damaging 1.00
R4518:Farp2 UTSW 1 93620641 missense probably benign 0.04
R4551:Farp2 UTSW 1 93618592 missense possibly damaging 0.92
R4723:Farp2 UTSW 1 93580899 missense probably benign 0.07
R4821:Farp2 UTSW 1 93574470 splice site probably null
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R5221:Farp2 UTSW 1 93576418 missense probably damaging 0.99
R5625:Farp2 UTSW 1 93528748 missense probably damaging 1.00
R5663:Farp2 UTSW 1 93570013 missense probably damaging 1.00
R5935:Farp2 UTSW 1 93620645 critical splice donor site probably null
R6593:Farp2 UTSW 1 93569940 missense possibly damaging 0.48
R6853:Farp2 UTSW 1 93570016 missense probably damaging 1.00
R7001:Farp2 UTSW 1 93620184 missense possibly damaging 0.94
R7001:Farp2 UTSW 1 93620230 missense possibly damaging 0.94
R7133:Farp2 UTSW 1 93621234 missense probably damaging 1.00
R7134:Farp2 UTSW 1 93603459 missense probably benign 0.04
R7184:Farp2 UTSW 1 93603415 missense probably damaging 1.00
R7219:Farp2 UTSW 1 93560318 missense probably damaging 0.97
R7234:Farp2 UTSW 1 93580119 missense possibly damaging 0.94
R7426:Farp2 UTSW 1 93621228 missense possibly damaging 0.55
R7503:Farp2 UTSW 1 93567497 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAATACATGACATTGTAGGTTCCTATG -3'
(R):5'- GGATCCTATCAGAATTTTAGCTGAAAG -3'

Sequencing Primer
(F):5'- CAACTAATGAAGAATGGGAGAGATAG -3'
(R):5'- ACCTCTTACAGGAATCTGG -3'
Posted On2019-06-07