Incidental Mutation 'PIT4468001:Arhgap15'
ID555624
Institutional Source Beutler Lab
Gene Symbol Arhgap15
Ensembl Gene ENSMUSG00000049744
Gene NameRho GTPase activating protein 15
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #PIT4468001 (G1)
Quality Score190.009
Status Not validated
Chromosome2
Chromosomal Location43748824-44395953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44243131 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 350 (Q350K)
Ref Sequence ENSEMBL: ENSMUSP00000056461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]
Predicted Effect probably damaging
Transcript: ENSMUST00000055776
AA Change: Q350K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: Q350K

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 473 1.55e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112822
SMART Domains Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744

DomainStartEndE-ValueType
Blast:PH 88 108 5e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112824
AA Change: Q350K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: Q350K

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 469 1.16e-35 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Farp2 G T 1: 93,528,777 E61* probably null Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mib1 T C 18: 10,798,463 S775P possibly damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Ntn4 A G 10: 93,644,725 T104A probably damaging Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1030 A T 2: 85,984,448 T203S probably benign Het
Olfr1271 C A 2: 90,266,220 C70F probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Vwa8 G T 14: 79,183,061 R1734L probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Arhgap15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Arhgap15 APN 2 44243153 missense probably damaging 1.00
IGL01779:Arhgap15 APN 2 44065045 missense possibly damaging 0.94
IGL02011:Arhgap15 APN 2 43780755 missense probably damaging 1.00
IGL02506:Arhgap15 APN 2 44063808 missense possibly damaging 0.73
IGL02659:Arhgap15 APN 2 44063837 missense probably damaging 1.00
IGL02711:Arhgap15 APN 2 44116662 missense possibly damaging 0.67
IGL02944:Arhgap15 APN 2 44142350 critical splice donor site probably null
IGL02989:Arhgap15 APN 2 43780736 missense probably damaging 1.00
R0140:Arhgap15 UTSW 2 44322767 missense probably damaging 1.00
R0403:Arhgap15 UTSW 2 44063766 missense probably damaging 0.98
R0557:Arhgap15 UTSW 2 44116617 missense possibly damaging 0.60
R0616:Arhgap15 UTSW 2 44116717 critical splice donor site probably null
R1122:Arhgap15 UTSW 2 44142295 missense probably benign 0.43
R1958:Arhgap15 UTSW 2 44243124 missense possibly damaging 0.67
R2258:Arhgap15 UTSW 2 44386347 missense probably damaging 1.00
R2905:Arhgap15 UTSW 2 44063786 missense probably damaging 0.97
R4788:Arhgap15 UTSW 2 43748890 start codon destroyed probably null 0.02
R4793:Arhgap15 UTSW 2 44142341 missense probably damaging 1.00
R5040:Arhgap15 UTSW 2 43844813 critical splice donor site probably null
R5093:Arhgap15 UTSW 2 44322755 missense probably damaging 1.00
R5114:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R5202:Arhgap15 UTSW 2 44063857 missense probably benign 0.22
R5446:Arhgap15 UTSW 2 43828760 missense probably benign 0.00
R5661:Arhgap15 UTSW 2 44322727 missense possibly damaging 0.54
R6747:Arhgap15 UTSW 2 44116677 missense probably damaging 1.00
R7392:Arhgap15 UTSW 2 44063774 missense possibly damaging 0.61
R7502:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R7630:Arhgap15 UTSW 2 43780636 missense probably benign 0.01
R7658:Arhgap15 UTSW 2 44142268 missense probably benign 0.18
R7735:Arhgap15 UTSW 2 44116630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTCCTACAGAAAACGGG -3'
(R):5'- CACGGGGCACATATTCTGTTC -3'

Sequencing Primer
(F):5'- GCTGTTAACGGTTGCTGA -3'
(R):5'- GGTCACGATCGGTATTGATCTCAC -3'
Posted On2019-06-07