Incidental Mutation 'PIT4468001:Olfr1030'
ID555625
Institutional Source Beutler Lab
Gene Symbol Olfr1030
Ensembl Gene ENSMUSG00000044923
Gene Nameolfactory receptor 1030
SynonymsGA_x6K02T2Q125-47462755-47463693, MOR196-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #PIT4468001 (G1)
Quality Score195.009
Status Not validated
Chromosome2
Chromosomal Location85979276-85988294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85984448 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 203 (T203S)
Ref Sequence ENSEMBL: ENSMUSP00000053309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849]
Predicted Effect probably benign
Transcript: ENSMUST00000056849
AA Change: T203S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923
AA Change: T203S

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Arhgap15 C A 2: 44,243,131 Q350K probably damaging Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Farp2 G T 1: 93,528,777 E61* probably null Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mib1 T C 18: 10,798,463 S775P possibly damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Ntn4 A G 10: 93,644,725 T104A probably damaging Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1271 C A 2: 90,266,220 C70F probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Vwa8 G T 14: 79,183,061 R1734L probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Olfr1030
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Olfr1030 APN 2 85984670 missense probably damaging 0.99
IGL01795:Olfr1030 APN 2 85984134 missense probably damaging 1.00
IGL02395:Olfr1030 APN 2 85984082 missense possibly damaging 0.76
IGL03277:Olfr1030 APN 2 85984173 missense probably damaging 0.99
R0458:Olfr1030 UTSW 2 85984256 missense probably benign 0.00
R1114:Olfr1030 UTSW 2 85984307 missense probably benign
R1642:Olfr1030 UTSW 2 85983857 missense probably benign 0.00
R2189:Olfr1030 UTSW 2 85984068 missense probably damaging 1.00
R4094:Olfr1030 UTSW 2 85984218 missense probably damaging 1.00
R4246:Olfr1030 UTSW 2 85984280 missense possibly damaging 0.90
R4677:Olfr1030 UTSW 2 85983971 missense possibly damaging 0.61
R5537:Olfr1030 UTSW 2 85984226 missense possibly damaging 0.83
R6018:Olfr1030 UTSW 2 85984804 utr 3 prime probably benign
R6531:Olfr1030 UTSW 2 85984307 missense probably benign
R7367:Olfr1030 UTSW 2 85984343 missense possibly damaging 0.68
R7611:Olfr1030 UTSW 2 85984063 nonsense probably null
R7693:Olfr1030 UTSW 2 85984635 missense probably damaging 1.00
R7753:Olfr1030 UTSW 2 85984716 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCCAAAGGTGTATGTGTGCG -3'
(R):5'- TGGACTGCTCCACTGATTTATC -3'

Sequencing Primer
(F):5'- GCGTCTGATTGCTGGTCCC -3'
(R):5'- ATCTGTGGGAGGTCTAACATACATGC -3'
Posted On2019-06-07