Incidental Mutation 'PIT4468001:Olfr1271'
ID555626
Institutional Source Beutler Lab
Gene Symbol Olfr1271
Ensembl Gene ENSMUSG00000075062
Gene Nameolfactory receptor 1271
SynonymsGA_x6K02T2Q125-51620802-51619885, MOR227-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #PIT4468001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90260546-90271032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90266220 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 70 (C70F)
Ref Sequence ENSEMBL: ENSMUSP00000149028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099751] [ENSMUST00000216383]
Predicted Effect probably benign
Transcript: ENSMUST00000099751
AA Change: C70F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097340
Gene: ENSMUSG00000075062
AA Change: C70F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.1e-50 PFAM
Pfam:7tm_1 39 285 6.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216383
AA Change: C70F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Arhgap15 C A 2: 44,243,131 Q350K probably damaging Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Farp2 G T 1: 93,528,777 E61* probably null Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mib1 T C 18: 10,798,463 S775P possibly damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Ntn4 A G 10: 93,644,725 T104A probably damaging Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1030 A T 2: 85,984,448 T203S probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Vwa8 G T 14: 79,183,061 R1734L probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Olfr1271
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1271 APN 2 90265951 missense probably damaging 0.97
IGL02901:Olfr1271 APN 2 90265708 missense probably damaging 1.00
PIT4466001:Olfr1271 UTSW 2 90266295 missense probably damaging 0.97
R0325:Olfr1271 UTSW 2 90265536 missense probably null
R1350:Olfr1271 UTSW 2 90266346 missense probably damaging 0.97
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R2509:Olfr1271 UTSW 2 90265686 missense possibly damaging 0.91
R2510:Olfr1271 UTSW 2 90265606 missense probably damaging 0.98
R4113:Olfr1271 UTSW 2 90266340 missense probably damaging 1.00
R5414:Olfr1271 UTSW 2 90265702 missense probably benign 0.07
R5580:Olfr1271 UTSW 2 90266350 missense probably benign 0.00
R5664:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R5666:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5670:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5881:Olfr1271 UTSW 2 90266442 unclassified probably null
R6493:Olfr1271 UTSW 2 90265708 missense probably damaging 1.00
R7688:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R7719:Olfr1271 UTSW 2 90266259 missense probably damaging 1.00
R8041:Olfr1271 UTSW 2 90266144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGCAGATGGCCACATAGCG -3'
(R):5'- TCAACACATGTGAGCTGACC -3'

Sequencing Primer
(F):5'- TAGCGATCGTAGGCCATCATC -3'
(R):5'- CACATGTGAGCTGACCCAATGG -3'
Posted On2019-06-07