Incidental Mutation 'PIT4468001:Ntn4'
ID 555652
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Name netrin 4
Synonyms beta-netrin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4468001 (G1)
Quality Score 188.009
Status Not validated
Chromosome 10
Chromosomal Location 93640681-93747207 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93644725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 104 (T104A)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000147080]
AlphaFold Q9JI33
Predicted Effect probably damaging
Transcript: ENSMUST00000020204
AA Change: T104A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: T104A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147080
AA Change: T67A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123306
Gene: ENSMUSG00000020019
AA Change: T67A

DomainStartEndE-ValueType
LamNT 1 143 4.24e-12 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Arhgap15 C A 2: 44,243,131 Q350K probably damaging Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Farp2 G T 1: 93,528,777 E61* probably null Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mib1 T C 18: 10,798,463 S775P possibly damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1030 A T 2: 85,984,448 T203S probably benign Het
Olfr1271 C A 2: 90,266,220 C70F probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Vwa8 G T 14: 79,183,061 R1734L probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0132:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
R7957:Ntn4 UTSW 10 93644473 splice site probably benign
R8092:Ntn4 UTSW 10 93741056 missense probably damaging 0.97
R8202:Ntn4 UTSW 10 93644903 missense possibly damaging 0.88
R8508:Ntn4 UTSW 10 93741104 missense possibly damaging 0.48
R9010:Ntn4 UTSW 10 93644644 missense
R9115:Ntn4 UTSW 10 93733813 missense probably benign
R9415:Ntn4 UTSW 10 93644626 missense probably benign 0.00
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCCGCTGTGAGAAAGC -3'
(R):5'- AGTACTTGTAAGGCTTCCAGG -3'

Sequencing Primer
(F):5'- TCGCATGGGAAACTTGGC -3'
(R):5'- TAAGGCTTCCAGGTCTTCCCAAAG -3'
Posted On 2019-06-07