Incidental Mutation 'PIT4468001:Vwa8'
ID555663
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Namevon Willebrand factor A domain containing 8
Synonyms4932416F07Rik, 1300010F03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4468001 (G1)
Quality Score203.009
Status Not validated
Chromosome14
Chromosomal Location78849052-79202310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79183061 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1734 (R1734L)
Ref Sequence ENSEMBL: ENSMUSP00000048925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990]
Predicted Effect probably damaging
Transcript: ENSMUST00000040990
AA Change: R1734L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: R1734L

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Arhgap15 C A 2: 44,243,131 Q350K probably damaging Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Farp2 G T 1: 93,528,777 E61* probably null Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mib1 T C 18: 10,798,463 S775P possibly damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Ntn4 A G 10: 93,644,725 T104A probably damaging Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1030 A T 2: 85,984,448 T203S probably benign Het
Olfr1271 C A 2: 90,266,220 C70F probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79038195 missense probably damaging 1.00
IGL01087:Vwa8 APN 14 78935229 missense probably benign 0.16
IGL01137:Vwa8 APN 14 79103647 missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79064913 nonsense probably null
IGL01449:Vwa8 APN 14 79182988 nonsense probably null
IGL01604:Vwa8 APN 14 79180804 missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79198354 missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79198277 missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79094284 missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 78984209 missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 78849293 missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 78947273 critical splice donor site probably null
IGL02393:Vwa8 APN 14 79182977 missense probably damaging 1.00
IGL02430:Vwa8 APN 14 78934645 critical splice donor site probably null
IGL02476:Vwa8 APN 14 78925341 missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79183112 missense probably benign 0.01
IGL02678:Vwa8 APN 14 78984200 missense probably damaging 0.99
IGL02797:Vwa8 APN 14 78925262 missense probably benign 0.29
IGL02806:Vwa8 APN 14 79157088 missense probably benign 0.35
IGL02811:Vwa8 APN 14 78994459 missense probably benign 0.21
IGL02892:Vwa8 APN 14 79103700 splice site probably benign
IGL03024:Vwa8 APN 14 78995098 missense probably benign 0.03
IGL03075:Vwa8 APN 14 78933756 missense probably damaging 0.99
IGL03090:Vwa8 APN 14 78934601 missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79058815 splice site probably benign
IGL03181:Vwa8 APN 14 79009250 missense probably benign 0.01
IGL03296:Vwa8 APN 14 79183100 missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79183134 splice site probably null
R6812_Vwa8_870 UTSW 14 79197419 missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79064921 missense probably benign 0.02
R0049:Vwa8 UTSW 14 79093739 missense probably benign 0.21
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0081:Vwa8 UTSW 14 79082782 missense probably benign 0.02
R0305:Vwa8 UTSW 14 79009273 missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79062676 missense probably damaging 1.00
R0514:Vwa8 UTSW 14 78947189 missense probably benign
R0602:Vwa8 UTSW 14 79020620 missense probably benign 0.00
R0615:Vwa8 UTSW 14 78908150 missense probably benign
R0791:Vwa8 UTSW 14 78994576 splice site probably benign
R1028:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79086654 nonsense probably null
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1412:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1421:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1539:Vwa8 UTSW 14 79062562 missense probably benign 0.00
R1556:Vwa8 UTSW 14 79086681 missense probably benign
R1589:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1590:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1591:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79182987 missense probably damaging 1.00
R1673:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79201103 missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 78908195 missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79081136 missense probably benign 0.04
R1926:Vwa8 UTSW 14 79020635 missense probably benign 0.00
R1959:Vwa8 UTSW 14 78982360 missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 78925254 splice site probably benign
R2078:Vwa8 UTSW 14 78908157 missense probably damaging 1.00
R2103:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79092403 critical splice donor site probably null
R2281:Vwa8 UTSW 14 79064996 missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 78912218 missense probably damaging 0.98
R2847:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2848:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2894:Vwa8 UTSW 14 79038138 missense probably damaging 1.00
R2991:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R3077:Vwa8 UTSW 14 79098342 missense probably benign 0.03
R3405:Vwa8 UTSW 14 79164220 splice site probably benign
R3406:Vwa8 UTSW 14 79164220 splice site probably benign
R3708:Vwa8 UTSW 14 79062696 splice site probably benign
R3779:Vwa8 UTSW 14 79102322 splice site probably benign
R3799:Vwa8 UTSW 14 79064896 missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79082852 missense probably benign 0.00
R4425:Vwa8 UTSW 14 79082806 missense probably benign 0.00
R4478:Vwa8 UTSW 14 78868801 missense probably benign 0.00
R4627:Vwa8 UTSW 14 79103697 critical splice donor site probably null
R4835:Vwa8 UTSW 14 78934613 missense probably benign 0.11
R4868:Vwa8 UTSW 14 79183082 missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79198283 missense probably benign 0.05
R5137:Vwa8 UTSW 14 79064902 missense probably damaging 1.00
R5156:Vwa8 UTSW 14 78984226 missense probably benign 0.00
R5658:Vwa8 UTSW 14 78982398 critical splice donor site probably null
R5841:Vwa8 UTSW 14 78994518 missense probably benign
R6057:Vwa8 UTSW 14 79082873 missense probably benign 0.21
R6244:Vwa8 UTSW 14 79086662 missense probably benign
R6264:Vwa8 UTSW 14 79086812 missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79094332 splice site probably null
R6332:Vwa8 UTSW 14 79197464 missense probably benign
R6395:Vwa8 UTSW 14 79093744 missense probably benign 0.02
R6472:Vwa8 UTSW 14 79009170 missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79096401 missense probably benign 0.00
R6527:Vwa8 UTSW 14 78947213 missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79198222 missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79197419 missense probably damaging 0.99
R6994:Vwa8 UTSW 14 78908156 missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 78912205 missense probably damaging 1.00
R7357:Vwa8 UTSW 14 79038201 missense probably null 1.00
R7363:Vwa8 UTSW 14 79018707 missense probably benign 0.05
R7381:Vwa8 UTSW 14 79095685 missense probably benign 0.00
R7406:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7484:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79082814 missense probably benign 0.24
R7500:Vwa8 UTSW 14 78925246 intron probably null
R7514:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 78935229 missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79098300 missense probably benign
R7703:Vwa8 UTSW 14 79026073 missense probably damaging 1.00
R7730:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R7775:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7778:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7824:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7885:Vwa8 UTSW 14 79020649 missense probably benign 0.00
R7902:Vwa8 UTSW 14 79092291 missense probably benign 0.00
R7968:Vwa8 UTSW 14 79020649 missense probably benign 0.00
R7985:Vwa8 UTSW 14 79092291 missense probably benign 0.00
Z1088:Vwa8 UTSW 14 78982246 missense probably benign 0.38
Z1177:Vwa8 UTSW 14 79058692 missense not run
Predicted Primers PCR Primer
(F):5'- CAGTCTGACATCTGCTTACTAGG -3'
(R):5'- TGCTGAGAGAATGGTGCCTG -3'

Sequencing Primer
(F):5'- GACAGCCCTGTACAGACCTG -3'
(R):5'- AGAATGGTGCCTGGAGCTC -3'
Posted On2019-06-07