Incidental Mutation 'PIT4468001:Umodl1'
ID555668
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4468001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30959278 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 76 (Y76C)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: Y76C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: Y76C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: Y76C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Arhgap15 C A 2: 44,243,131 Q350K probably damaging Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Farp2 G T 1: 93,528,777 E61* probably null Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mib1 T C 18: 10,798,463 S775P possibly damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Ntn4 A G 10: 93,644,725 T104A probably damaging Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1030 A T 2: 85,984,448 T203S probably benign Het
Olfr1271 C A 2: 90,266,220 C70F probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Vwa8 G T 14: 79,183,061 R1734L probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTTTGCTAATACATCCTCCATG -3'
(R):5'- AGGATTCCAGGGAGACATCG -3'

Sequencing Primer
(F):5'- CATGGTCTTCTTTGTAGAAAATGGCC -3'
(R):5'- GGAGACATCGCAGGCTTG -3'
Posted On2019-06-07