Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4468001:Umodl1'

555668

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4468001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31173614-31229684 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31178252 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 76 (Y76C)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably damaging
Transcript: ENSMUST00000066554
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: Y76C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066981
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: Y76C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114555
AA Change: Y76C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: Y76C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 93.0%
3x: 90.7%
10x: 85.2%
20x: 72.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	C	T	14: 4,348,940 (GRCm38)	L34F	probably damaging	Het
Alms1	T	C	6: 85,601,701 (GRCm39)		probably null	Het
Arhgap15	C	A	2: 44,133,143 (GRCm39)	Q350K	probably damaging	Het
Bbs1	T	A	19: 4,956,190 (GRCm39)	H35L	probably benign	Het
Cep85	T	C	4: 133,876,008 (GRCm39)	N468S	probably damaging	Het
Chd8	T	C	14: 52,455,338 (GRCm39)	I1050V	possibly damaging	Het
Chd8	A	C	14: 52,445,453 (GRCm39)	D1709E	probably benign	Het
Clec9a	G	A	6: 129,396,597 (GRCm39)		probably null	Het
Cyp2c70	T	A	19: 40,153,806 (GRCm39)	D261V	probably damaging	Het
Deup1	T	C	9: 15,475,301 (GRCm39)	N420D	possibly damaging	Het
Dpys	T	A	15: 39,720,601 (GRCm39)	D53V	probably damaging	Het
Edem1	A	G	6: 108,821,828 (GRCm39)	E295G	probably damaging	Het
Farp2	G	T	1: 93,456,499 (GRCm39)	E61*	probably null	Het
Fat3	T	G	9: 15,907,647 (GRCm39)	D2785A	probably benign	Het
Fbxo30	T	A	10: 11,166,700 (GRCm39)	M474K	possibly damaging	Het
Gm13090	C	A	4: 151,175,539 (GRCm39)	P93Q	unknown	Het
Gm21976	A	T	13: 98,443,535 (GRCm39)	R229*	probably null	Het
Gpr108	A	T	17: 57,554,563 (GRCm39)	L25Q	probably null	Het
Hdac9	C	A	12: 34,145,933 (GRCm39)	V920F	unknown	Het
Ighv13-2	T	C	12: 114,321,593 (GRCm39)	S49G	probably benign	Het
Krt6a	T	C	15: 101,602,352 (GRCm39)	Y111C	probably damaging	Het
Mib1	T	C	18: 10,798,463 (GRCm39)	S775P	possibly damaging	Het
Mki67	A	G	7: 135,300,876 (GRCm39)	I1386T	probably benign	Het
Mroh2b	A	G	15: 4,942,294 (GRCm39)	E352G	probably damaging	Het
Nfya	A	G	17: 48,702,805 (GRCm39)	M61T	unknown	Het
Ntn4	A	G	10: 93,480,587 (GRCm39)	T104A	probably damaging	Het
Numb	G	A	12: 83,854,921 (GRCm39)	T135I	probably damaging	Het
Or4b12	C	A	2: 90,096,564 (GRCm39)	C70F	probably benign	Het
Or52ab4	A	C	7: 102,987,807 (GRCm39)	E182A	probably damaging	Het
Or5m5	A	T	2: 85,814,792 (GRCm39)	T203S	probably benign	Het
Parpbp	A	C	10: 87,979,935 (GRCm39)	L7R	probably benign	Het
Pcdhb8	T	C	18: 37,489,686 (GRCm39)	Y455H	probably damaging	Het
Pcdhga10	T	A	18: 37,880,936 (GRCm39)	D232E	probably damaging	Het
Pcdhga9	T	A	18: 37,872,527 (GRCm39)	C785*	probably null	Het
Pkd1l3	A	G	8: 110,391,131 (GRCm39)	Y1913C	possibly damaging	Het
Pld4	T	G	12: 112,734,256 (GRCm39)	L374R	probably damaging	Het
Ppp1r13b	A	T	12: 111,805,136 (GRCm39)	I350N	probably benign	Het
Rc3h2	C	A	2: 37,289,651 (GRCm39)	G387V	probably damaging	Het
Rfwd3	T	C	8: 112,009,352 (GRCm39)	H408R	probably benign	Het
Rpl3l	A	G	17: 24,954,457 (GRCm39)	T173A	probably benign	Het
Sdad1	T	C	5: 92,439,777 (GRCm39)	D416G	probably damaging	Het
Srp72	C	A	5: 77,142,053 (GRCm39)	T430K	probably benign	Het
Steap1	C	A	5: 5,786,642 (GRCm39)	G265V	probably damaging	Het
Sulf2	A	T	2: 165,922,720 (GRCm39)	I670N	probably benign	Het
Tcf7l2	A	T	19: 55,730,820 (GRCm39)	D16V	probably damaging	Het
Tmem100	T	A	11: 89,926,187 (GRCm39)	S5T	probably benign	Het
Tnc	C	A	4: 63,882,904 (GRCm39)	D1906Y	probably damaging	Het
Trak1	T	C	9: 121,282,398 (GRCm39)	S436P	probably benign	Het
Ttyh1	T	C	7: 4,122,771 (GRCm39)	Y40H	possibly damaging	Het
Ubxn8	T	A	8: 34,111,569 (GRCm39)	S275C	probably benign	Het
Upk3b	C	T	5: 136,071,861 (GRCm39)	T222M	probably benign	Het
Usp42	T	A	5: 143,700,399 (GRCm39)	K1208M	probably damaging	Het
Vmn2r25	A	T	6: 123,816,557 (GRCm39)	D341E	probably benign	Het
Vmn2r83	T	G	10: 79,313,884 (GRCm39)	L164R	probably damaging	Het
Vwa8	G	T	14: 79,420,501 (GRCm39)	R1734L	probably damaging	Het
Zfand2b	G	T	1: 75,146,476 (GRCm39)	R117L	probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31,227,724 (GRCm39)	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	31,215,238 (GRCm39)	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	31,215,233 (GRCm39)	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	31,217,800 (GRCm39)	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	31,215,229 (GRCm39)	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	31,201,294 (GRCm39)	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	31,192,742 (GRCm39)	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	31,206,888 (GRCm39)	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	31,205,091 (GRCm39)	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	31,213,789 (GRCm39)	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	31,187,415 (GRCm39)	splice site	probably benign
IGL02496:Umodl1	APN	17	31,217,628 (GRCm39)	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	31,208,462 (GRCm39)	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	31,205,473 (GRCm39)	nonsense	probably null
IGL03392:Umodl1	APN	17	31,215,329 (GRCm39)	missense	probably damaging	0.98
Disquieting	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
floored	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7231_umodl1_507	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
surprising	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
unsettling	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
G1citation:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	31,203,002 (GRCm39)	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	31,215,325 (GRCm39)	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	31,178,347 (GRCm39)	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31,221,772 (GRCm39)	splice site	probably benign
R1231:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	31,205,478 (GRCm39)	missense	probably benign	0.05
R1459:Umodl1	UTSW	17	31,201,232 (GRCm39)	splice site	probably benign
R1510:Umodl1	UTSW	17	31,178,203 (GRCm39)	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	31,206,942 (GRCm39)	missense	probably benign
R1757:Umodl1	UTSW	17	31,227,674 (GRCm39)	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	31,187,524 (GRCm39)	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	31,201,238 (GRCm39)	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	31,211,128 (GRCm39)	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	31,211,062 (GRCm39)	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	31,211,147 (GRCm39)	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	31,208,502 (GRCm39)	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31,221,837 (GRCm39)	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	31,203,763 (GRCm39)	nonsense	probably null
R4207:Umodl1	UTSW	17	31,178,341 (GRCm39)	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	31,207,039 (GRCm39)	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	31,213,789 (GRCm39)	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	31,217,088 (GRCm39)	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	31,202,976 (GRCm39)	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	31,218,175 (GRCm39)	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	31,205,055 (GRCm39)	missense	probably benign
R4993:Umodl1	UTSW	17	31,205,459 (GRCm39)	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	31,203,066 (GRCm39)	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	31,199,333 (GRCm39)	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	31,201,263 (GRCm39)	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	31,213,761 (GRCm39)	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	31,215,256 (GRCm39)	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31,221,866 (GRCm39)	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	31,201,325 (GRCm39)	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	31,205,121 (GRCm39)	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	31,205,273 (GRCm39)	splice site	probably null
R6822:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
R6999:Umodl1	UTSW	17	31,218,097 (GRCm39)	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	31,201,246 (GRCm39)	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	31,201,318 (GRCm39)	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	31,201,236 (GRCm39)	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	31,205,595 (GRCm39)	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	31,201,306 (GRCm39)	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	31,217,122 (GRCm39)	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7594:Umodl1	UTSW	17	31,173,779 (GRCm39)	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7763:Umodl1	UTSW	17	31,205,430 (GRCm39)	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	31,178,125 (GRCm39)	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	31,192,666 (GRCm39)	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	31,205,361 (GRCm39)	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	31,192,770 (GRCm39)	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	31,190,792 (GRCm39)	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	31,203,806 (GRCm39)	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	31,202,958 (GRCm39)	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	31,192,677 (GRCm39)	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	31,178,147 (GRCm39)	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	31,215,367 (GRCm39)	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	31,217,143 (GRCm39)	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	31,217,152 (GRCm39)	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	31,178,324 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTTTGCTAATACATCCTCCATG -3'
(R):5'- AGGATTCCAGGGAGACATCG -3'

Sequencing Primer
(F):5'- CATGGTCTTCTTTGTAGAAAATGGCC -3'
(R):5'- GGAGACATCGCAGGCTTG -3'

Posted On

2019-06-07