Incidental Mutation 'PIT4618001:Cd55'
ID555678
Institutional Source Beutler Lab
Gene Symbol Cd55
Ensembl Gene ENSMUSG00000026399
Gene NameCD55 molecule, decay accelerating factor for complement
Synonymscomplement-glycosylphosphatidylinositol, Daf1, Cromer blood group, GPI-DAF, Daf-GPI
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130439027-130462744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130456869 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 206 (V206I)
Ref Sequence ENSEMBL: ENSMUSP00000027650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027650]
Predicted Effect probably benign
Transcript: ENSMUST00000027650
AA Change: V206I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027650
Gene: ENSMUSG00000026399
AA Change: V206I

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CCP 36 94 2.21e-12 SMART
CCP 98 158 3.56e-7 SMART
CCP 163 220 6.34e-13 SMART
CCP 225 284 1.28e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140400
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. The encoded preproprotein undergoes post-translational processing to generate a mature polypeptide anchored to the plasma membrane via a glycosylphosphatidylinositol moiety. Erythrocytes from mice deficient in the encoded protein exhibit impaired regulation of complement activation resulting in enhanced complement deposition. Mice lacking the encoded protein exhibit enhanced susceptibility to experimentally induced myasthenia gravis. This gene is located adjacent to a closely related gene on chromosome 1. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant mice show increased susceptibility to injury following ethanol exposure, to experimental autoimmune myasthenia gravis and to acute nephrotoxic nephritis. Another allele results in an abnormal complement cascade leading to increased C3 deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Cd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Cd55 APN 1 130452511 nonsense probably null
IGL02207:Cd55 APN 1 130452419 missense possibly damaging 0.46
IGL02724:Cd55 APN 1 130449412 splice site probably benign
IGL02933:Cd55 APN 1 130452524 missense probably damaging 1.00
IGL02955:Cd55 APN 1 130449482 missense probably damaging 0.98
IGL03198:Cd55 APN 1 130440371 missense probably benign 0.03
R0055:Cd55 UTSW 1 130459576 splice site probably benign
R0411:Cd55 UTSW 1 130462557 splice site probably benign
R0426:Cd55 UTSW 1 130448372 missense probably benign 0.07
R1488:Cd55 UTSW 1 130448378 missense probably damaging 0.98
R1728:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1728:Cd55 UTSW 1 130459633 missense probably benign
R1729:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1729:Cd55 UTSW 1 130459633 missense probably benign
R1730:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1730:Cd55 UTSW 1 130459633 missense probably benign
R1739:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1739:Cd55 UTSW 1 130459633 missense probably benign
R1762:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1762:Cd55 UTSW 1 130459633 missense probably benign
R1783:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1783:Cd55 UTSW 1 130459633 missense probably benign
R1784:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1784:Cd55 UTSW 1 130459633 missense probably benign
R1785:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1785:Cd55 UTSW 1 130459633 missense probably benign
R1835:Cd55 UTSW 1 130447609 splice site probably benign
R2049:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2122:Cd55 UTSW 1 130459617 missense possibly damaging 0.94
R2141:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2142:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2935:Cd55 UTSW 1 130452426 missense possibly damaging 0.65
R4326:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4328:Cd55 UTSW 1 130447367 intron probably benign
R4328:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4329:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R5051:Cd55 UTSW 1 130448348 missense probably damaging 0.99
R6467:Cd55 UTSW 1 130447611 splice site probably benign
R7219:Cd55 UTSW 1 130462606 missense possibly damaging 0.73
R8010:Cd55 UTSW 1 130459616 missense probably benign 0.00
Z1088:Cd55 UTSW 1 130452479 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTAAGAGTCCTCCCACAGCTG -3'
(R):5'- CCATTTCAGTATCATCTCTGTGAGC -3'

Sequencing Primer
(F):5'- GTCCTCCCACAGCTGATAAATTAAG -3'
(R):5'- CATCTCTGTGAGCTAAATTTTTAACC -3'
Posted On2019-06-07