Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4618001:Cd55'

555678

Institutional Source

Beutler Lab

Gene Symbol

Cd55

Ensembl Gene

ENSMUSG00000026399

Gene Name

CD55 molecule, decay accelerating factor for complement

Synonyms

complement-glycosylphosphatidylinositol, Daf1, Cromer blood group, GPI-DAF, Daf-GPI

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4618001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130439027-130462744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 130456869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 206 (V206I)

Ref Sequence

ENSEMBL: ENSMUSP00000027650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027650]

AlphaFold

Q61475

Predicted Effect

probably benign
Transcript: ENSMUST00000027650
AA Change: V206I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027650
Gene: ENSMUSG00000026399
AA Change: V206I

Domain	Start	End	E-Value	Type
low complexity region	11	30	N/A	INTRINSIC
CCP	36	94	2.21e-12	SMART
CCP	98	158	3.56e-7	SMART
CCP	163	220	6.34e-13	SMART
CCP	225	284	1.28e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140400

Coding Region Coverage

1x: 93.4%
3x: 91.0%
10x: 85.9%
20x: 75.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. The encoded preproprotein undergoes post-translational processing to generate a mature polypeptide anchored to the plasma membrane via a glycosylphosphatidylinositol moiety. Erythrocytes from mice deficient in the encoded protein exhibit impaired regulation of complement activation resulting in enhanced complement deposition. Mice lacking the encoded protein exhibit enhanced susceptibility to experimentally induced myasthenia gravis. This gene is located adjacent to a closely related gene on chromosome 1. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant mice show increased susceptibility to injury following ethanol exposure, to experimental autoimmune myasthenia gravis and to acute nephrotoxic nephritis. Another allele results in an abnormal complement cascade leading to increased C3 deposition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,709	D64V	probably damaging	Het
Ankdd1a	A	C	9: 65,507,650	I268S	possibly damaging	Het
Atad3a	C	T	4: 155,750,138	R402Q	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Cd8a	A	G	6: 71,373,677	D42G	possibly damaging	Het
Cemip	G	T	7: 83,943,939	F1185L	probably benign	Het
Cfap58	A	G	19: 47,975,514	D527G	probably damaging	Het
Cyp2a12	C	A	7: 27,034,773	S377Y	probably benign	Het
Dapk2	A	G	9: 66,268,686	D289G	probably benign	Het
Efcab6	G	A	15: 83,983,446	A277V	probably benign	Het
Ephx2	A	T	14: 66,102,222	F250L	probably damaging	Het
Flg2	A	T	3: 93,203,781	S1039C	unknown	Het
Gm609	A	G	16: 45,443,934	F87S	probably benign	Het
Gramd1a	A	G	7: 31,132,596	V674A	probably benign	Het
Gtf2a1	A	C	12: 91,567,769	V237G	probably benign	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Jagn1	T	A	6: 113,447,437	L90H	probably damaging	Het
Mdn1	G	T	4: 32,746,527	A4158S	probably benign	Het
Myh11	G	A	16: 14,201,066	A1839V		Het
Olr1	G	A	6: 129,499,906	A132V	probably damaging	Het
Paqr3	A	T	5: 97,103,471	H131Q	possibly damaging	Het
Pde4b	A	T	4: 102,602,812	T397S	probably benign	Het
Pon1	A	G	6: 5,168,349	C353R	probably damaging	Het
Ppie	G	A	4: 123,138,868	T43I	probably null	Het
Prr5l	A	G	2: 101,758,530	F92L	probably damaging	Het
Rai14	T	C	15: 10,575,156	Y601C	probably damaging	Het
Rasal1	A	G	5: 120,670,376	D491G	probably damaging	Het
Rbm12b1	T	A	4: 12,145,441	V471E	probably damaging	Het
Rpusd2	T	C	2: 119,038,452	L452P	possibly damaging	Het
Scgb2b24	A	T	7: 33,738,611	C24S	probably damaging	Het
Slc17a5	C	T	9: 78,538,248	V468M	possibly damaging	Het
Tcp10c	A	G	17: 13,356,510	K117R	possibly damaging	Het
Ubash3b	A	G	9: 41,016,627	S584P	probably benign	Het
Vps13b	C	T	15: 35,709,240	R1778C	probably damaging	Het
Ythdc2	A	G	18: 44,834,598	I220M	probably benign	Het
Zfp474	C	A	18: 52,638,404	T43K	probably damaging	Het
Zscan4-ps3	G	A	7: 11,613,334	M432I	probably benign	Het

Other mutations in Cd55

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Cd55	APN	1	130452511	nonsense	probably null
IGL02207:Cd55	APN	1	130452419	missense	possibly damaging	0.46
IGL02724:Cd55	APN	1	130449412	splice site	probably benign
IGL02933:Cd55	APN	1	130452524	missense	probably damaging	1.00
IGL02955:Cd55	APN	1	130449482	missense	probably damaging	0.98
IGL03198:Cd55	APN	1	130440371	missense	probably benign	0.03
R0055:Cd55	UTSW	1	130459576	splice site	probably benign
R0411:Cd55	UTSW	1	130462557	splice site	probably benign
R0426:Cd55	UTSW	1	130448372	missense	probably benign	0.07
R1488:Cd55	UTSW	1	130448378	missense	probably damaging	0.98
R1728:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1728:Cd55	UTSW	1	130459633	missense	probably benign
R1729:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1729:Cd55	UTSW	1	130459633	missense	probably benign
R1730:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1730:Cd55	UTSW	1	130459633	missense	probably benign
R1739:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1739:Cd55	UTSW	1	130459633	missense	probably benign
R1762:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1762:Cd55	UTSW	1	130459633	missense	probably benign
R1783:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1783:Cd55	UTSW	1	130459633	missense	probably benign
R1784:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1784:Cd55	UTSW	1	130459633	missense	probably benign
R1785:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R1785:Cd55	UTSW	1	130459633	missense	probably benign
R1835:Cd55	UTSW	1	130447609	splice site	probably benign
R2049:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R2122:Cd55	UTSW	1	130459617	missense	possibly damaging	0.94
R2141:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R2142:Cd55	UTSW	1	130449423	missense	probably benign	0.32
R2935:Cd55	UTSW	1	130452426	missense	possibly damaging	0.65
R4326:Cd55	UTSW	1	130452483	missense	probably damaging	1.00
R4328:Cd55	UTSW	1	130447367	intron	probably benign
R4328:Cd55	UTSW	1	130452483	missense	probably damaging	1.00
R4329:Cd55	UTSW	1	130452483	missense	probably damaging	1.00
R5051:Cd55	UTSW	1	130448348	missense	probably damaging	0.99
R6467:Cd55	UTSW	1	130447611	splice site	probably benign
R7219:Cd55	UTSW	1	130462606	missense	possibly damaging	0.73
R8010:Cd55	UTSW	1	130459616	missense	probably benign	0.00
R8695:Cd55	UTSW	1	130452536	missense	probably benign	0.00
R8882:Cd55	UTSW	1	130459764	missense	probably benign	0.02
R9369:Cd55	UTSW	1	130447450	nonsense	probably null
R9411:Cd55	UTSW	1	130440377	missense	probably benign	0.03
Z1088:Cd55	UTSW	1	130452479	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTTAAGAGTCCTCCCACAGCTG -3'
(R):5'- CCATTTCAGTATCATCTCTGTGAGC -3'

Sequencing Primer
(F):5'- GTCCTCCCACAGCTGATAAATTAAG -3'
(R):5'- CATCTCTGTGAGCTAAATTTTTAACC -3'

Posted On

2019-06-07