Incidental Mutation 'PIT4618001:Prr5l'
ID555679
Institutional Source Beutler Lab
Gene Symbol Prr5l
Ensembl Gene ENSMUSG00000032841
Gene Nameproline rich 5 like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #PIT4618001 (G1)
Quality Score214.009
Status Not validated
Chromosome2
Chromosomal Location101714285-101883027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101758530 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 92 (F92L)
Ref Sequence ENSEMBL: ENSMUSP00000042167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043845] [ENSMUST00000125985] [ENSMUST00000154525] [ENSMUST00000163762] [ENSMUST00000171088]
Predicted Effect probably damaging
Transcript: ENSMUST00000043845
AA Change: F92L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042167
Gene: ENSMUSG00000032841
AA Change: F92L

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 47 152 5.4e-15 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125985
AA Change: F92L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122996
Gene: ENSMUSG00000032841
AA Change: F92L

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 128 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141814
SMART Domains Protein: ENSMUSP00000118537
Gene: ENSMUSG00000032841

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
low complexity region 56 69 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154525
AA Change: F92L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120192
Gene: ENSMUSG00000032841
AA Change: F92L

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 95 2.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163762
AA Change: F92L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127530
Gene: ENSMUSG00000032841
AA Change: F92L

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171088
AA Change: F92L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130152
Gene: ENSMUSG00000032841
AA Change: F92L

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Pfam:HbrB 45 177 2.8e-36 PFAM
low complexity region 323 332 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Prr5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Prr5l APN 2 101772120 splice site probably benign
IGL02946:Prr5l APN 2 101772184 splice site probably null
R0652:Prr5l UTSW 2 101772290 missense possibly damaging 0.94
R0722:Prr5l UTSW 2 101717474 splice site probably benign
R0882:Prr5l UTSW 2 101758541 missense possibly damaging 0.81
R1962:Prr5l UTSW 2 101758509 critical splice donor site probably null
R3013:Prr5l UTSW 2 101734705 missense probably damaging 1.00
R4564:Prr5l UTSW 2 101746749 missense probably damaging 1.00
R4604:Prr5l UTSW 2 101729448 missense probably benign 0.44
R4902:Prr5l UTSW 2 101797682 utr 5 prime probably benign
R5338:Prr5l UTSW 2 101717107 missense probably benign 0.00
R6279:Prr5l UTSW 2 101717420 nonsense probably null
R6792:Prr5l UTSW 2 101717424 missense probably benign 0.00
R7214:Prr5l UTSW 2 101729432 missense probably benign
R7299:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7301:Prr5l UTSW 2 101717286 missense probably damaging 1.00
R7672:Prr5l UTSW 2 101734738 missense probably damaging 1.00
R7702:Prr5l UTSW 2 101717097 missense probably benign 0.04
R8086:Prr5l UTSW 2 101741364 missense probably benign 0.00
R8116:Prr5l UTSW 2 101797574 frame shift probably null
R8297:Prr5l UTSW 2 101741285 critical splice donor site probably null
R8470:Prr5l UTSW 2 101717085 missense probably benign 0.06
RF028:Prr5l UTSW 2 101797573 frame shift probably null
RF033:Prr5l UTSW 2 101797573 frame shift probably null
RF039:Prr5l UTSW 2 101797573 frame shift probably null
X0018:Prr5l UTSW 2 101717259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATCTCCACTCACATCAGG -3'
(R):5'- AGAGCATTCCTTCCTCCAGC -3'

Sequencing Primer
(F):5'- CTCACATCAGGGACCAAGTGG -3'
(R):5'- AGCCTCGGTCCCTACCC -3'
Posted On2019-06-07