Incidental Mutation 'PIT4618001:Rbm12b1'
ID 555683
Institutional Source Beutler Lab
Gene Symbol Rbm12b1
Ensembl Gene ENSMUSG00000046667
Gene Name RNA binding motif protein 12 B1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # PIT4618001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 12140264-12146731 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12145441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 471 (V471E)
Ref Sequence ENSEMBL: ENSMUSP00000053555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050069] [ENSMUST00000069128]
AlphaFold Q80YR9
Predicted Effect probably damaging
Transcript: ENSMUST00000050069
AA Change: V471E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053555
Gene: ENSMUSG00000046667
AA Change: V471E

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069128
AA Change: V471E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064195
Gene: ENSMUSG00000046667
AA Change: V471E

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Rbm12b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Rbm12b1 APN 4 12146038 missense probably damaging 0.99
IGL02103:Rbm12b1 APN 4 12145563 missense probably damaging 0.99
IGL03165:Rbm12b1 APN 4 12145845 missense possibly damaging 0.94
R0449:Rbm12b1 UTSW 4 12145507 missense probably benign 0.00
R0528:Rbm12b1 UTSW 4 12145657 missense probably benign 0.00
R0571:Rbm12b1 UTSW 4 12146248 missense probably benign 0.00
R1476:Rbm12b1 UTSW 4 12145817 missense possibly damaging 0.74
R1709:Rbm12b1 UTSW 4 12145827 missense probably benign 0.00
R1759:Rbm12b1 UTSW 4 12145424 missense probably damaging 1.00
R1967:Rbm12b1 UTSW 4 12146304 missense probably benign 0.00
R2055:Rbm12b1 UTSW 4 12145606 missense probably benign 0.05
R2425:Rbm12b1 UTSW 4 12146443 missense probably damaging 0.99
R4015:Rbm12b1 UTSW 4 12145491 missense probably benign 0.04
R4332:Rbm12b1 UTSW 4 12145655 missense probably benign 0.02
R5773:Rbm12b1 UTSW 4 12145765 missense probably damaging 1.00
R6497:Rbm12b1 UTSW 4 12146431 missense probably benign 0.00
R7740:Rbm12b1 UTSW 4 12145954 missense probably benign 0.00
R7761:Rbm12b1 UTSW 4 12146460 missense possibly damaging 0.92
R8083:Rbm12b1 UTSW 4 12146409 missense probably damaging 1.00
R8129:Rbm12b1 UTSW 4 12145549 missense probably damaging 1.00
R8389:Rbm12b1 UTSW 4 12146363 missense probably damaging 1.00
R8932:Rbm12b1 UTSW 4 12145689 missense probably benign 0.00
R9302:Rbm12b1 UTSW 4 12146181 missense probably benign 0.13
Z1088:Rbm12b1 UTSW 4 12146079 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAGTGCAGAAGTTCTTTGC -3'
(R):5'- ACTGCCGGAAATACCCTTGG -3'

Sequencing Primer
(F):5'- GCAGAAGTTCTTTGCAGACTTTTC -3'
(R):5'- GGGATGCTTGAAATGACCCATTTTC -3'
Posted On 2019-06-07