Incidental Mutation 'PIT4618001:Rbm12b1'
ID 555683
Institutional Source Beutler Lab
Gene Symbol Rbm12b1
Ensembl Gene ENSMUSG00000046667
Gene Name RNA binding motif protein 12 B1
Synonyms Rbm12b, 3000004N20Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.212) question?
Stock # PIT4618001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 12140264-12146731 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12145441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 471 (V471E)
Ref Sequence ENSEMBL: ENSMUSP00000053555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050069] [ENSMUST00000069128]
AlphaFold Q80YR9
Predicted Effect probably damaging
Transcript: ENSMUST00000050069
AA Change: V471E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053555
Gene: ENSMUSG00000046667
AA Change: V471E

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069128
AA Change: V471E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064195
Gene: ENSMUSG00000046667
AA Change: V471E

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,693,575 (GRCm39) D64V probably damaging Het
Ankdd1a A C 9: 65,414,932 (GRCm39) I268S possibly damaging Het
Atad3a C T 4: 155,834,595 (GRCm39) R402Q probably benign Het
C3ar1 A G 6: 122,827,746 (GRCm39) V157A probably benign Het
Cd200l1 A G 16: 45,264,297 (GRCm39) F87S probably benign Het
Cd55 C T 1: 130,384,606 (GRCm39) V206I probably benign Het
Cd8a A G 6: 71,350,661 (GRCm39) D42G possibly damaging Het
Cemip G T 7: 83,593,147 (GRCm39) F1185L probably benign Het
Cfap58 A G 19: 47,963,953 (GRCm39) D527G probably damaging Het
Cyp2a12 C A 7: 26,734,198 (GRCm39) S377Y probably benign Het
Dapk2 A G 9: 66,175,968 (GRCm39) D289G probably benign Het
Efcab6 G A 15: 83,867,647 (GRCm39) A277V probably benign Het
Ephx2 A T 14: 66,339,671 (GRCm39) F250L probably damaging Het
Flg2 A T 3: 93,111,088 (GRCm39) S1039C unknown Het
Gramd1a A G 7: 30,832,021 (GRCm39) V674A probably benign Het
Gtf2a1 A C 12: 91,534,543 (GRCm39) V237G probably benign Het
I830077J02Rik G A 3: 105,833,886 (GRCm39) T90M probably damaging Het
Jagn1 T A 6: 113,424,398 (GRCm39) L90H probably damaging Het
Mdn1 G T 4: 32,746,527 (GRCm39) A4158S probably benign Het
Myh11 G A 16: 14,018,930 (GRCm39) A1839V Het
Olr1 G A 6: 129,476,869 (GRCm39) A132V probably damaging Het
Paqr3 A T 5: 97,251,330 (GRCm39) H131Q possibly damaging Het
Pde4b A T 4: 102,460,009 (GRCm39) T397S probably benign Het
Pon1 A G 6: 5,168,349 (GRCm39) C353R probably damaging Het
Ppie G A 4: 123,032,661 (GRCm39) T43I probably null Het
Prr5l A G 2: 101,588,875 (GRCm39) F92L probably damaging Het
Rai14 T C 15: 10,575,242 (GRCm39) Y601C probably damaging Het
Rasal1 A G 5: 120,808,441 (GRCm39) D491G probably damaging Het
Rpusd2 T C 2: 118,868,933 (GRCm39) L452P possibly damaging Het
Scgb2b24 A T 7: 33,438,036 (GRCm39) C24S probably damaging Het
Slc17a5 C T 9: 78,445,530 (GRCm39) V468M possibly damaging Het
Tcp10c A G 17: 13,576,772 (GRCm39) K117R possibly damaging Het
Ubash3b A G 9: 40,927,923 (GRCm39) S584P probably benign Het
Vps13b C T 15: 35,709,386 (GRCm39) R1778C probably damaging Het
Ythdc2 A G 18: 44,967,665 (GRCm39) I220M probably benign Het
Zfp474 C A 18: 52,771,476 (GRCm39) T43K probably damaging Het
Zscan4-ps3 G A 7: 11,347,261 (GRCm39) M432I probably benign Het
Other mutations in Rbm12b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Rbm12b1 APN 4 12,146,038 (GRCm39) missense probably damaging 0.99
IGL02103:Rbm12b1 APN 4 12,145,563 (GRCm39) missense probably damaging 0.99
IGL03165:Rbm12b1 APN 4 12,145,845 (GRCm39) missense possibly damaging 0.94
R0449:Rbm12b1 UTSW 4 12,145,507 (GRCm39) missense probably benign 0.00
R0528:Rbm12b1 UTSW 4 12,145,657 (GRCm39) missense probably benign 0.00
R0571:Rbm12b1 UTSW 4 12,146,248 (GRCm39) missense probably benign 0.00
R1476:Rbm12b1 UTSW 4 12,145,817 (GRCm39) missense possibly damaging 0.74
R1709:Rbm12b1 UTSW 4 12,145,827 (GRCm39) missense probably benign 0.00
R1759:Rbm12b1 UTSW 4 12,145,424 (GRCm39) missense probably damaging 1.00
R1967:Rbm12b1 UTSW 4 12,146,304 (GRCm39) missense probably benign 0.00
R2055:Rbm12b1 UTSW 4 12,145,606 (GRCm39) missense probably benign 0.05
R2425:Rbm12b1 UTSW 4 12,146,443 (GRCm39) missense probably damaging 0.99
R4015:Rbm12b1 UTSW 4 12,145,491 (GRCm39) missense probably benign 0.04
R4332:Rbm12b1 UTSW 4 12,145,655 (GRCm39) missense probably benign 0.02
R5773:Rbm12b1 UTSW 4 12,145,765 (GRCm39) missense probably damaging 1.00
R6497:Rbm12b1 UTSW 4 12,146,431 (GRCm39) missense probably benign 0.00
R7740:Rbm12b1 UTSW 4 12,145,954 (GRCm39) missense probably benign 0.00
R7761:Rbm12b1 UTSW 4 12,146,460 (GRCm39) missense possibly damaging 0.92
R8083:Rbm12b1 UTSW 4 12,146,409 (GRCm39) missense probably damaging 1.00
R8129:Rbm12b1 UTSW 4 12,145,549 (GRCm39) missense probably damaging 1.00
R8389:Rbm12b1 UTSW 4 12,146,363 (GRCm39) missense probably damaging 1.00
R8932:Rbm12b1 UTSW 4 12,145,689 (GRCm39) missense probably benign 0.00
R9302:Rbm12b1 UTSW 4 12,146,181 (GRCm39) missense probably benign 0.13
Z1088:Rbm12b1 UTSW 4 12,146,079 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAGTGCAGAAGTTCTTTGC -3'
(R):5'- ACTGCCGGAAATACCCTTGG -3'

Sequencing Primer
(F):5'- GCAGAAGTTCTTTGCAGACTTTTC -3'
(R):5'- GGGATGCTTGAAATGACCCATTTTC -3'
Posted On 2019-06-07