Incidental Mutation 'PIT4618001:Rbm12b1'
ID555683
Institutional Source Beutler Lab
Gene Symbol Rbm12b1
Ensembl Gene ENSMUSG00000046667
Gene NameRNA binding motif protein 12 B1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location12140264-12146731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12145441 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 471 (V471E)
Ref Sequence ENSEMBL: ENSMUSP00000053555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050069] [ENSMUST00000069128]
Predicted Effect probably damaging
Transcript: ENSMUST00000050069
AA Change: V471E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053555
Gene: ENSMUSG00000046667
AA Change: V471E

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069128
AA Change: V471E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064195
Gene: ENSMUSG00000046667
AA Change: V471E

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Rbm12b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Rbm12b1 APN 4 12146038 missense probably damaging 0.99
IGL02103:Rbm12b1 APN 4 12145563 missense probably damaging 0.99
IGL03165:Rbm12b1 APN 4 12145845 missense possibly damaging 0.94
R0449:Rbm12b1 UTSW 4 12145507 missense probably benign 0.00
R0528:Rbm12b1 UTSW 4 12145657 missense probably benign 0.00
R0571:Rbm12b1 UTSW 4 12146248 missense probably benign 0.00
R1476:Rbm12b1 UTSW 4 12145817 missense possibly damaging 0.74
R1709:Rbm12b1 UTSW 4 12145827 missense probably benign 0.00
R1759:Rbm12b1 UTSW 4 12145424 missense probably damaging 1.00
R1967:Rbm12b1 UTSW 4 12146304 missense probably benign 0.00
R2055:Rbm12b1 UTSW 4 12145606 missense probably benign 0.05
R2425:Rbm12b1 UTSW 4 12146443 missense probably damaging 0.99
R4015:Rbm12b1 UTSW 4 12145491 missense probably benign 0.04
R4332:Rbm12b1 UTSW 4 12145655 missense probably benign 0.02
R5773:Rbm12b1 UTSW 4 12145765 missense probably damaging 1.00
R6497:Rbm12b1 UTSW 4 12146431 missense probably benign 0.00
R7740:Rbm12b1 UTSW 4 12145954 missense probably benign 0.00
R7761:Rbm12b1 UTSW 4 12146460 missense possibly damaging 0.92
R8083:Rbm12b1 UTSW 4 12146409 missense probably damaging 1.00
R8129:Rbm12b1 UTSW 4 12145549 missense probably damaging 1.00
Z1088:Rbm12b1 UTSW 4 12146079 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAGTGCAGAAGTTCTTTGC -3'
(R):5'- ACTGCCGGAAATACCCTTGG -3'

Sequencing Primer
(F):5'- GCAGAAGTTCTTTGCAGACTTTTC -3'
(R):5'- GGGATGCTTGAAATGACCCATTTTC -3'
Posted On2019-06-07