Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4618001:Pde4b'

555685

Institutional Source

Beutler Lab

Gene Symbol

Pde4b

Ensembl Gene

ENSMUSG00000028525

Gene Name

phosphodiesterase 4B, cAMP specific

Synonyms

dunce, Dpde4

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

PIT4618001 (G1)

Quality Score

164.009

Status

Not validated

Chromosome

Chromosomal Location

102087543-102607259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 102602812 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 397 (T397S)

Ref Sequence

ENSEMBL: ENSMUSP00000102514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030251] [ENSMUST00000097949] [ENSMUST00000097950] [ENSMUST00000106901] [ENSMUST00000106904] [ENSMUST00000106908] [ENSMUST00000106911]

Predicted Effect

probably benign
Transcript: ENSMUST00000030251

SMART Domains

Protein: ENSMUSP00000030251
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
HDc	151	326	2.35e-5	SMART
low complexity region	433	446	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097949

SMART Domains

Protein: ENSMUSP00000095561
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
HDc	170	345	2.35e-5	SMART
low complexity region	452	465	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097950

SMART Domains

Protein: ENSMUSP00000095562
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
low complexity region	5	24	N/A	INTRINSIC
HDc	231	406	2.35e-5	SMART
low complexity region	513	526	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106901
AA Change: T397S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000102514
Gene: ENSMUSG00000028525
AA Change: T397S

Domain	Start	End	E-Value	Type
HDc	170	345	2.35e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106904

SMART Domains

Protein: ENSMUSP00000102517
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
HDc	326	501	2.35e-5	SMART
low complexity region	608	621	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106908

SMART Domains

Protein: ENSMUSP00000102521
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
HDc	388	563	2.35e-5	SMART
low complexity region	670	683	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106911

SMART Domains

Protein: ENSMUSP00000102524
Gene: ENSMUSG00000028525

Domain	Start	End	E-Value	Type
low complexity region	23	33	N/A	INTRINSIC
low complexity region	74	83	N/A	INTRINSIC
HDc	403	578	2.35e-5	SMART
low complexity region	685	698	N/A	INTRINSIC

Coding Region Coverage

1x: 93.4%
3x: 91.0%
10x: 85.9%
20x: 75.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene produce significantly less TNF-alpha in response to lipopolysaccharide stimulation. One mutation resulted in brain and spinal cord vacuoles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,709	D64V	probably damaging	Het
Ankdd1a	A	C	9: 65,507,650	I268S	possibly damaging	Het
Atad3a	C	T	4: 155,750,138	R402Q	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Cd55	C	T	1: 130,456,869	V206I	probably benign	Het
Cd8a	A	G	6: 71,373,677	D42G	possibly damaging	Het
Cemip	G	T	7: 83,943,939	F1185L	probably benign	Het
Cfap58	A	G	19: 47,975,514	D527G	probably damaging	Het
Cyp2a12	C	A	7: 27,034,773	S377Y	probably benign	Het
Dapk2	A	G	9: 66,268,686	D289G	probably benign	Het
Efcab6	G	A	15: 83,983,446	A277V	probably benign	Het
Ephx2	A	T	14: 66,102,222	F250L	probably damaging	Het
Flg2	A	T	3: 93,203,781	S1039C	unknown	Het
Gm609	A	G	16: 45,443,934	F87S	probably benign	Het
Gramd1a	A	G	7: 31,132,596	V674A	probably benign	Het
Gtf2a1	A	C	12: 91,567,769	V237G	probably benign	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Jagn1	T	A	6: 113,447,437	L90H	probably damaging	Het
Mdn1	G	T	4: 32,746,527	A4158S	probably benign	Het
Myh11	G	A	16: 14,201,066	A1839V		Het
Olr1	G	A	6: 129,499,906	A132V	probably damaging	Het
Paqr3	A	T	5: 97,103,471	H131Q	possibly damaging	Het
Pon1	A	G	6: 5,168,349	C353R	probably damaging	Het
Ppie	G	A	4: 123,138,868	T43I	probably null	Het
Prr5l	A	G	2: 101,758,530	F92L	probably damaging	Het
Rai14	T	C	15: 10,575,156	Y601C	probably damaging	Het
Rasal1	A	G	5: 120,670,376	D491G	probably damaging	Het
Rbm12b1	T	A	4: 12,145,441	V471E	probably damaging	Het
Rpusd2	T	C	2: 119,038,452	L452P	possibly damaging	Het
Scgb2b24	A	T	7: 33,738,611	C24S	probably damaging	Het
Slc17a5	C	T	9: 78,538,248	V468M	possibly damaging	Het
Tcp10c	A	G	17: 13,356,510	K117R	possibly damaging	Het
Ubash3b	A	G	9: 41,016,627	S584P	probably benign	Het
Vps13b	C	T	15: 35,709,240	R1778C	probably damaging	Het
Ythdc2	A	G	18: 44,834,598	I220M	probably benign	Het
Zfp474	C	A	18: 52,638,404	T43K	probably damaging	Het
Zscan4-ps3	G	A	7: 11,613,334	M432I	probably benign	Het

Other mutations in Pde4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Pde4b	APN	4	102506044	critical splice donor site	probably null
IGL01146:Pde4b	APN	4	102255263	missense	possibly damaging	0.80
IGL01377:Pde4b	APN	4	102487402	missense	probably damaging	1.00
IGL01549:Pde4b	APN	4	102605068	missense	probably damaging	0.97
IGL01739:Pde4b	APN	4	102601635	missense	probably damaging	0.97
IGL01791:Pde4b	APN	4	102590930	splice site	probably benign
IGL02211:Pde4b	APN	4	102590822	splice site	probably benign
IGL02578:Pde4b	APN	4	102255297	missense	possibly damaging	0.94
IGL02878:Pde4b	APN	4	102601639	missense	probably damaging	1.00
PIT4458001:Pde4b	UTSW	4	102602678	missense	probably damaging	1.00
R0102:Pde4b	UTSW	4	102590178	missense	probably benign	0.15
R0230:Pde4b	UTSW	4	102597510	missense	probably benign	0.01
R0530:Pde4b	UTSW	4	102602651	missense	probably damaging	0.96
R0704:Pde4b	UTSW	4	102487392	missense	probably damaging	0.99
R1115:Pde4b	UTSW	4	102542155	intron	probably benign
R1450:Pde4b	UTSW	4	102601635	missense	probably damaging	0.97
R1457:Pde4b	UTSW	4	102605176	missense	probably damaging	0.99
R1568:Pde4b	UTSW	4	102597699	missense	probably damaging	1.00
R1740:Pde4b	UTSW	4	102487351	missense	probably damaging	1.00
R1784:Pde4b	UTSW	4	102605260	missense	probably benign	0.02
R1960:Pde4b	UTSW	4	102597460	missense	probably damaging	0.99
R1961:Pde4b	UTSW	4	102597460	missense	probably damaging	0.99
R2033:Pde4b	UTSW	4	102605295	missense	probably benign	0.43
R2210:Pde4b	UTSW	4	102597475	missense	probably damaging	1.00
R2848:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R2936:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R3195:Pde4b	UTSW	4	102599643	missense	probably damaging	0.99
R3196:Pde4b	UTSW	4	102599643	missense	probably damaging	0.99
R3695:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R3699:Pde4b	UTSW	4	102601545	missense	probably damaging	1.00
R4014:Pde4b	UTSW	4	102555625	missense	probably benign	0.00
R4627:Pde4b	UTSW	4	102601605	missense	probably damaging	1.00
R4852:Pde4b	UTSW	4	102597770	missense	probably damaging	1.00
R5055:Pde4b	UTSW	4	102195114	intron	probably benign
R5109:Pde4b	UTSW	4	102601544	missense	probably damaging	1.00
R5319:Pde4b	UTSW	4	102421788	utr 3 prime	probably benign
R5476:Pde4b	UTSW	4	102602699	missense	probably benign	0.00
R5576:Pde4b	UTSW	4	102430162	missense	probably damaging	0.98
R6019:Pde4b	UTSW	4	102570769	missense	possibly damaging	0.56
R6151:Pde4b	UTSW	4	102601551	missense	probably damaging	1.00
R6540:Pde4b	UTSW	4	102601876	missense	probably damaging	1.00
R6573:Pde4b	UTSW	4	102430162	missense	probably damaging	0.98
R6662:Pde4b	UTSW	4	102601898	missense	possibly damaging	0.82
R6751:Pde4b	UTSW	4	102602671	missense	probably damaging	0.98
R7066:Pde4b	UTSW	4	102602806	missense	probably benign	0.03
R7092:Pde4b	UTSW	4	102601851	missense	probably damaging	1.00
R7461:Pde4b	UTSW	4	102255306	missense	probably damaging	1.00
R7613:Pde4b	UTSW	4	102255306	missense	probably damaging	1.00
R8068:Pde4b	UTSW	4	102596015	missense	probably damaging	1.00
R8296:Pde4b	UTSW	4	102602786	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- ACTGTGCAGACCTGAGCAAC -3'
(R):5'- GTACAGGTGCTCATGTGTCC -3'

Sequencing Primer
(F):5'- CAAGTCCTTGGAATTGTATCGGC -3'
(R):5'- GTGTCCACCAAATCTGATGAGGTC -3'

Posted On

2019-06-07