Incidental Mutation 'PIT4618001:Atad3a'
ID555687
Institutional Source Beutler Lab
Gene Symbol Atad3a
Ensembl Gene ENSMUSG00000029036
Gene NameATPase family, AAA domain containing 3A
SynonymsTob3, 2400004H09Rik
Accession Numbers

Genbank: NM_179203; MGI:1919214

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155740641-155761093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155750138 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 402 (R402Q)
Ref Sequence ENSEMBL: ENSMUSP00000030903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030903] [ENSMUST00000176043] [ENSMUST00000184913]
Predicted Effect probably benign
Transcript: ENSMUST00000030903
AA Change: R402Q

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030903
Gene: ENSMUSG00000029036
AA Change: R402Q

DomainStartEndE-ValueType
Pfam:DUF3523 26 285 9.5e-113 PFAM
AAA 343 482 4.43e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175679
Predicted Effect probably benign
Transcript: ENSMUST00000176043
SMART Domains Protein: ENSMUSP00000135405
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 20 193 5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184131
Predicted Effect probably benign
Transcript: ENSMUST00000184913
SMART Domains Protein: ENSMUSP00000138808
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 1 125 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed mitochondrial membrane protein that contributes to mitochondrial dynamics, nucleoid organization, protein translation, cell growth, and cholesterol metabolism. This gene is a member of the ATPase family AAA-domain containing 3 gene family which, in humans, includes two other paralogs. Naturally occurring mutations in this gene are associated with distinct neurological syndromes including Harel-Yoon syndrome. High-level expression of this gene is associated with poor survival in breast cancer patients. A homozygous knockout of the orthologous gene in mice results in embryonic lethality at day 7.5 due to growth retardation and defective development of the trophoblast lineage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele die around E7.5 exhibiting growth retardation, failure to gastrulate, and impaired development of the trophoblast lineage immediately after implantation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Atad3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Atad3a APN 4 155746078 missense probably damaging 0.98
IGL01982:Atad3a APN 4 155753927 missense possibly damaging 0.94
IGL02059:Atad3a APN 4 155754750 splice site probably benign
IGL02572:Atad3a APN 4 155753584 missense possibly damaging 0.61
IGL03086:Atad3a APN 4 155748670 critical splice donor site probably null
IGL03409:Atad3a APN 4 155747350 missense probably damaging 0.99
E2594:Atad3a UTSW 4 155750933 unclassified probably benign
FR4976:Atad3a UTSW 4 155753939 missense probably damaging 0.98
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0601:Atad3a UTSW 4 155747407 missense probably damaging 1.00
R0799:Atad3a UTSW 4 155747470 missense probably damaging 1.00
R1428:Atad3a UTSW 4 155755682 missense probably damaging 1.00
R1597:Atad3a UTSW 4 155751435 critical splice donor site probably null
R2188:Atad3a UTSW 4 155751519 missense probably damaging 0.99
R4126:Atad3a UTSW 4 155754061 splice site probably benign
R4564:Atad3a UTSW 4 155747309 splice site probably null
R5334:Atad3a UTSW 4 155755689 missense probably damaging 1.00
R6354:Atad3a UTSW 4 155753945 missense possibly damaging 0.58
R6481:Atad3a UTSW 4 155753641 splice site probably null
R7220:Atad3a UTSW 4 155754041 missense probably benign 0.02
R7689:Atad3a UTSW 4 155756153 missense probably damaging 0.98
R7949:Atad3a UTSW 4 155748695 missense possibly damaging 0.53
R8127:Atad3a UTSW 4 155753939 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATATCTGATTGGCAGCACCC -3'
(R):5'- GGACTCTGAAGGGAACATCTG -3'

Sequencing Primer
(F):5'- GGCATGACATCTTCTCTAATGGAC -3'
(R):5'- ACTCTGAAGGGAACATCTGCTCTG -3'
Posted On2019-06-07