Incidental Mutation 'PIT4618001:Paqr3'
ID555688
Institutional Source Beutler Lab
Gene Symbol Paqr3
Ensembl Gene ENSMUSG00000055725
Gene Nameprogestin and adipoQ receptor family member III
Synonyms6330415A20Rik, RKTG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location97082329-97111596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97103471 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 131 (H131Q)
Ref Sequence ENSEMBL: ENSMUSP00000069324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069453] [ENSMUST00000112968] [ENSMUST00000112969] [ENSMUST00000196078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069453
AA Change: H131Q

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725
AA Change: H131Q

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112968
AA Change: H131Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108592
Gene: ENSMUSG00000055725
AA Change: H131Q

DomainStartEndE-ValueType
Pfam:HlyIII 64 171 1.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112969
AA Change: H131Q

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725
AA Change: H131Q

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196078
AA Change: H131Q

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142871
Gene: ENSMUSG00000055725
AA Change: H131Q

DomainStartEndE-ValueType
Pfam:HlyIII 64 179 7e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted deletion of this gene causes faster chemical carcinogen-induced skin cell proliferation, higher epidermal thickness, increased number and size of skin papillomas, shorter tumor latency and delayed tumor regression. Heterozygotes develop tumors earlier and more frequently than control mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Paqr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Paqr3 APN 5 97095937 missense probably benign
IGL01966:Paqr3 APN 5 97099643 missense probably benign 0.21
IGL02133:Paqr3 APN 5 97095931 missense probably benign
R1601:Paqr3 UTSW 5 97111389 missense probably benign 0.01
R2864:Paqr3 UTSW 5 97099736 missense possibly damaging 0.65
R3419:Paqr3 UTSW 5 97099700 missense probably damaging 1.00
R3799:Paqr3 UTSW 5 97111316 missense probably damaging 1.00
R4352:Paqr3 UTSW 5 97099596 missense probably benign 0.05
R4368:Paqr3 UTSW 5 97108291 missense probably damaging 1.00
R4515:Paqr3 UTSW 5 97103361 missense possibly damaging 0.72
R4583:Paqr3 UTSW 5 97108210 nonsense probably null
R4647:Paqr3 UTSW 5 97108210 nonsense probably null
R4648:Paqr3 UTSW 5 97108210 nonsense probably null
R4811:Paqr3 UTSW 5 97095983 missense probably benign 0.00
R4855:Paqr3 UTSW 5 97108194 missense possibly damaging 0.83
R5910:Paqr3 UTSW 5 97096028 splice site probably null
R6053:Paqr3 UTSW 5 97111278 missense probably benign 0.12
R6156:Paqr3 UTSW 5 97108269 missense probably damaging 1.00
R6957:Paqr3 UTSW 5 97108251 missense possibly damaging 0.48
R6974:Paqr3 UTSW 5 97108287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAAACCAGTGCAAGAAGCCC -3'
(R):5'- ACTGGTGAACTCGTGAACCTG -3'

Sequencing Primer
(F):5'- GTGCAAGAAGCCCCAAATCCTATC -3'
(R):5'- TCGTGAACCTGACATCAGTG -3'
Posted On2019-06-07