Incidental Mutation 'PIT4618001:1700028K03Rik'
ID555689
Institutional Source Beutler Lab
Gene Symbol 1700028K03Rik
Ensembl Gene ENSMUSG00000089798
Gene NameRIKEN cDNA 1700028K03 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location107534709-107551542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107545709 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 64 (D64V)
Ref Sequence ENSEMBL: ENSMUSP00000058373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058921] [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000124546] [ENSMUST00000159902] [ENSMUST00000160160]
Predicted Effect probably damaging
Transcript: ENSMUST00000058921
AA Change: D64V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058373
Gene: ENSMUSG00000089798
AA Change: D64V

DomainStartEndE-ValueType
Pfam:DUF4580 12 173 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078021
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082121
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100949
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159902
AA Change: D64V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124574
Gene: ENSMUSG00000089798
AA Change: D64V

DomainStartEndE-ValueType
Pfam:DUF4580 10 177 1.4e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160160
AA Change: D64V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124398
Gene: ENSMUSG00000106631
AA Change: D64V

DomainStartEndE-ValueType
Pfam:DUF4580 10 140 1.5e-61 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in 1700028K03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:1700028K03Rik APN 5 107543950 nonsense probably null
IGL02152:1700028K03Rik APN 5 107548117 missense probably benign 0.05
R0519:1700028K03Rik UTSW 5 107548201 missense probably benign 0.34
R2040:1700028K03Rik UTSW 5 107545741 missense probably benign
R2858:1700028K03Rik UTSW 5 107545801 missense probably benign 0.33
R5618:1700028K03Rik UTSW 5 107548199 nonsense probably null
R6408:1700028K03Rik UTSW 5 107543992 missense probably damaging 1.00
R7545:1700028K03Rik UTSW 5 107548174 missense probably damaging 1.00
R7911:1700028K03Rik UTSW 5 107545801 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCACTTTGACAGTCATTACAGAAC -3'
(R):5'- AAGACTGGCTGTGCTTTGCTTC -3'

Sequencing Primer
(F):5'- CACCTGGCTTGAAAGGTTAAC -3'
(R):5'- CCATACCTCTGATGTATCCTGAAC -3'
Posted On2019-06-07