Incidental Mutation 'PIT4618001:Rasal1'
ID 555690
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene Name RAS protein activator like 1 (GAP1 like)
Synonyms MRASAL
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4618001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 120648812-120679597 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120670376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 491 (D491G)
Ref Sequence ENSEMBL: ENSMUSP00000031606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000156722]
AlphaFold Q9Z268
Predicted Effect probably damaging
Transcript: ENSMUST00000031606
AA Change: D491G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: D491G

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156722
AA Change: D491G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: D491G

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2966:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4643:Rasal1 UTSW 5 120678964 missense probably benign 0.05
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5171:Rasal1 UTSW 5 120663764 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6136:Rasal1 UTSW 5 120675478 missense possibly damaging 0.84
R6159:Rasal1 UTSW 5 120659608 missense probably damaging 1.00
R6292:Rasal1 UTSW 5 120659620 missense probably damaging 0.97
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
R7042:Rasal1 UTSW 5 120663960 splice site probably null
R7194:Rasal1 UTSW 5 120675492 missense probably benign
R7356:Rasal1 UTSW 5 120654825 missense possibly damaging 0.65
R7406:Rasal1 UTSW 5 120662937 missense probably benign 0.11
R7662:Rasal1 UTSW 5 120662184 missense probably benign 0.36
R8089:Rasal1 UTSW 5 120671578 missense probably damaging 1.00
R8320:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8321:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8362:Rasal1 UTSW 5 120675420 missense probably damaging 1.00
R8368:Rasal1 UTSW 5 120671550 missense probably damaging 1.00
R8379:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8380:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8383:Rasal1 UTSW 5 120666355 missense probably benign 0.01
R8710:Rasal1 UTSW 5 120662937 missense probably benign 0.11
R8817:Rasal1 UTSW 5 120670351 missense probably damaging 0.96
R9258:Rasal1 UTSW 5 120655090 missense possibly damaging 0.91
R9300:Rasal1 UTSW 5 120664107 missense probably damaging 1.00
R9394:Rasal1 UTSW 5 120678681 missense probably benign
R9746:Rasal1 UTSW 5 120662293 missense probably damaging 1.00
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Z1176:Rasal1 UTSW 5 120652816 missense probably damaging 1.00
Z1176:Rasal1 UTSW 5 120664849 missense probably benign 0.00
Z1177:Rasal1 UTSW 5 120676838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTTGTTGCCTCAGTTT -3'
(R):5'- GCCCAGCAAGTCCATGAC -3'

Sequencing Primer
(F):5'- CTCAGTTTCCCCAGCTGG -3'
(R):5'- TACATACATGCATGCGTACACTC -3'
Posted On 2019-06-07