Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4618001:Pon1'

555691

Institutional Source

Beutler Lab

Gene Symbol

Pon1

Ensembl Gene

ENSMUSG00000002588

Gene Name

paraoxonase 1

Synonyms

Pon

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4618001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5168090-5193946 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5168349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 353 (C353R)

Ref Sequence

ENSEMBL: ENSMUSP00000002663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002663] [ENSMUST00000035813] [ENSMUST00000176945] [ENSMUST00000177159]

AlphaFold

P52430

Predicted Effect

probably damaging
Transcript: ENSMUST00000002663
AA Change: C353R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002663
Gene: ENSMUSG00000002588
AA Change: C353R

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
Pfam:SGL	83	308	1.9e-13	PFAM
Pfam:Arylesterase	168	253	9e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000035813

SMART Domains

Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	5e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
SAM	986	1052	6.41e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176945

SMART Domains

Protein: ENSMUSP00000135728
Gene: ENSMUSG00000002588

Domain	Start	End	E-Value	Type
PDB:3SRG\|A	1	165	9e-86	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177159

SMART Domains

Protein: ENSMUSP00000135195
Gene: ENSMUSG00000002588

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
Pfam:Arylesterase	145	186	2.1e-7	PFAM

Coding Region Coverage

1x: 93.4%
3x: 91.0%
10x: 85.9%
20x: 75.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is an arylesterase that mainly hydrolyzes paroxon to produce p-nitrophenol. Paroxon is an organophosphorus anticholinesterase compound that is produced in vivo by oxidation of the insecticide parathion. Polymorphisms in this gene are a risk factor in coronary artery disease. The gene is found in a cluster of three related paraoxonase genes at 7q21.3. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to organophosphate toxicity and atherosclerosis when fed a high-fat/cholesterol diet. Females exhibit increased LDL and VLD cholesterol levels. Macrophages show increased oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,709	D64V	probably damaging	Het
Ankdd1a	A	C	9: 65,507,650	I268S	possibly damaging	Het
Atad3a	C	T	4: 155,750,138	R402Q	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Cd55	C	T	1: 130,456,869	V206I	probably benign	Het
Cd8a	A	G	6: 71,373,677	D42G	possibly damaging	Het
Cemip	G	T	7: 83,943,939	F1185L	probably benign	Het
Cfap58	A	G	19: 47,975,514	D527G	probably damaging	Het
Cyp2a12	C	A	7: 27,034,773	S377Y	probably benign	Het
Dapk2	A	G	9: 66,268,686	D289G	probably benign	Het
Efcab6	G	A	15: 83,983,446	A277V	probably benign	Het
Ephx2	A	T	14: 66,102,222	F250L	probably damaging	Het
Flg2	A	T	3: 93,203,781	S1039C	unknown	Het
Gm609	A	G	16: 45,443,934	F87S	probably benign	Het
Gramd1a	A	G	7: 31,132,596	V674A	probably benign	Het
Gtf2a1	A	C	12: 91,567,769	V237G	probably benign	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Jagn1	T	A	6: 113,447,437	L90H	probably damaging	Het
Mdn1	G	T	4: 32,746,527	A4158S	probably benign	Het
Myh11	G	A	16: 14,201,066	A1839V		Het
Olr1	G	A	6: 129,499,906	A132V	probably damaging	Het
Paqr3	A	T	5: 97,103,471	H131Q	possibly damaging	Het
Pde4b	A	T	4: 102,602,812	T397S	probably benign	Het
Ppie	G	A	4: 123,138,868	T43I	probably null	Het
Prr5l	A	G	2: 101,758,530	F92L	probably damaging	Het
Rai14	T	C	15: 10,575,156	Y601C	probably damaging	Het
Rasal1	A	G	5: 120,670,376	D491G	probably damaging	Het
Rbm12b1	T	A	4: 12,145,441	V471E	probably damaging	Het
Rpusd2	T	C	2: 119,038,452	L452P	possibly damaging	Het
Scgb2b24	A	T	7: 33,738,611	C24S	probably damaging	Het
Slc17a5	C	T	9: 78,538,248	V468M	possibly damaging	Het
Tcp10c	A	G	17: 13,356,510	K117R	possibly damaging	Het
Ubash3b	A	G	9: 41,016,627	S584P	probably benign	Het
Vps13b	C	T	15: 35,709,240	R1778C	probably damaging	Het
Ythdc2	A	G	18: 44,834,598	I220M	probably benign	Het
Zfp474	C	A	18: 52,638,404	T43K	probably damaging	Het
Zscan4-ps3	G	A	7: 11,613,334	M432I	probably benign	Het

Other mutations in Pon1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01655:Pon1	APN	6	5175760	missense	probably damaging	1.00
IGL02511:Pon1	APN	6	5193724	missense	probably damaging	1.00
IGL02604:Pon1	APN	6	5168375	missense	probably damaging	1.00
R0717:Pon1	UTSW	6	5193674	critical splice donor site	probably null
R0838:Pon1	UTSW	6	5175758	missense	possibly damaging	0.75
R2365:Pon1	UTSW	6	5171746	missense	probably damaging	1.00
R4525:Pon1	UTSW	6	5177412	critical splice acceptor site	probably null
R5229:Pon1	UTSW	6	5177295	missense	possibly damaging	0.56
R5412:Pon1	UTSW	6	5185314	missense	probably damaging	1.00
R5973:Pon1	UTSW	6	5185334	missense	probably damaging	1.00
R6594:Pon1	UTSW	6	5185314	missense	probably damaging	1.00
R6985:Pon1	UTSW	6	5168345	missense	probably benign	0.01
R7439:Pon1	UTSW	6	5177399	missense	probably damaging	1.00
R7543:Pon1	UTSW	6	5168400	missense	possibly damaging	0.68
R7691:Pon1	UTSW	6	5175819	missense	probably benign	0.01
R7756:Pon1	UTSW	6	5168344	missense	probably benign
R7758:Pon1	UTSW	6	5168344	missense	probably benign
R8444:Pon1	UTSW	6	5177327	nonsense	probably null
R8478:Pon1	UTSW	6	5185318	missense	probably damaging	1.00
R8517:Pon1	UTSW	6	5171769	missense	probably benign	0.02
R9346:Pon1	UTSW	6	5193722	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGACTTGAGAAATTTAGCCATTTTGG -3'
(R):5'- TCACCTCATGCAATTTCTTTGACAG -3'

Sequencing Primer
(F):5'- CAAGAAACCCTTGCTAGTTAGGATC -3'
(R):5'- TGACAGGTGCTTCGAATCCAG -3'

Posted On

2019-06-07