Incidental Mutation 'PIT4618001:Pon1'
ID555691
Institutional Source Beutler Lab
Gene Symbol Pon1
Ensembl Gene ENSMUSG00000002588
Gene Nameparaoxonase 1
SynonymsPon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location5168090-5193946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5168349 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 353 (C353R)
Ref Sequence ENSEMBL: ENSMUSP00000002663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002663] [ENSMUST00000035813] [ENSMUST00000176945] [ENSMUST00000177159]
Predicted Effect probably damaging
Transcript: ENSMUST00000002663
AA Change: C353R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002663
Gene: ENSMUSG00000002588
AA Change: C353R

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:SGL 83 308 1.9e-13 PFAM
Pfam:Arylesterase 168 253 9e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035813
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176945
SMART Domains Protein: ENSMUSP00000135728
Gene: ENSMUSG00000002588

DomainStartEndE-ValueType
PDB:3SRG|A 1 165 9e-86 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000177159
SMART Domains Protein: ENSMUSP00000135195
Gene: ENSMUSG00000002588

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Arylesterase 145 186 2.1e-7 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is an arylesterase that mainly hydrolyzes paroxon to produce p-nitrophenol. Paroxon is an organophosphorus anticholinesterase compound that is produced in vivo by oxidation of the insecticide parathion. Polymorphisms in this gene are a risk factor in coronary artery disease. The gene is found in a cluster of three related paraoxonase genes at 7q21.3. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased susceptibility to organophosphate toxicity and atherosclerosis when fed a high-fat/cholesterol diet. Females exhibit increased LDL and VLD cholesterol levels. Macrophages show increased oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Pon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Pon1 APN 6 5175760 missense probably damaging 1.00
IGL02511:Pon1 APN 6 5193724 missense probably damaging 1.00
IGL02604:Pon1 APN 6 5168375 missense probably damaging 1.00
R0717:Pon1 UTSW 6 5193674 critical splice donor site probably null
R0838:Pon1 UTSW 6 5175758 missense possibly damaging 0.75
R2365:Pon1 UTSW 6 5171746 missense probably damaging 1.00
R4525:Pon1 UTSW 6 5177412 critical splice acceptor site probably null
R5229:Pon1 UTSW 6 5177295 missense possibly damaging 0.56
R5412:Pon1 UTSW 6 5185314 missense probably damaging 1.00
R5973:Pon1 UTSW 6 5185334 missense probably damaging 1.00
R6594:Pon1 UTSW 6 5185314 missense probably damaging 1.00
R6985:Pon1 UTSW 6 5168345 missense probably benign 0.01
R7439:Pon1 UTSW 6 5177399 missense probably damaging 1.00
R7543:Pon1 UTSW 6 5168400 missense possibly damaging 0.68
R7691:Pon1 UTSW 6 5175819 missense probably benign 0.01
R7756:Pon1 UTSW 6 5168344 missense probably benign
R7758:Pon1 UTSW 6 5168344 missense probably benign
R8444:Pon1 UTSW 6 5177327 nonsense probably null
R8478:Pon1 UTSW 6 5185318 missense probably damaging 1.00
R8517:Pon1 UTSW 6 5171769 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGACTTGAGAAATTTAGCCATTTTGG -3'
(R):5'- TCACCTCATGCAATTTCTTTGACAG -3'

Sequencing Primer
(F):5'- CAAGAAACCCTTGCTAGTTAGGATC -3'
(R):5'- TGACAGGTGCTTCGAATCCAG -3'
Posted On2019-06-07