Incidental Mutation 'PIT4618001:Olr1'
ID555695
Institutional Source Beutler Lab
Gene Symbol Olr1
Ensembl Gene ENSMUSG00000030162
Gene Nameoxidized low density lipoprotein (lectin-like) receptor 1
SynonymsLOX-1, Scare1, SR-EI
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location129485244-129507165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129499906 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 132 (A132V)
Ref Sequence ENSEMBL: ENSMUSP00000032265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032265] [ENSMUST00000162815] [ENSMUST00000182784] [ENSMUST00000183258]
Predicted Effect probably damaging
Transcript: ENSMUST00000032265
AA Change: A132V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032265
Gene: ENSMUSG00000030162
AA Change: A132V

DomainStartEndE-ValueType
Blast:CLECT 45 186 4e-13 BLAST
low complexity region 202 226 N/A INTRINSIC
CLECT 235 355 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162815
SMART Domains Protein: ENSMUSP00000124660
Gene: ENSMUSG00000030162

DomainStartEndE-ValueType
Blast:CLECT 24 75 1e-8 BLAST
low complexity region 76 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182784
SMART Domains Protein: ENSMUSP00000138588
Gene: ENSMUSG00000030162

DomainStartEndE-ValueType
CLECT 61 181 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183258
SMART Domains Protein: ENSMUSP00000138228
Gene: ENSMUSG00000030162

DomainStartEndE-ValueType
CLECT 27 147 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203564
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Olr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Olr1 APN 6 129493523 missense probably benign 0.02
IGL01751:Olr1 APN 6 129488848 missense possibly damaging 0.62
IGL02308:Olr1 APN 6 129499897 missense possibly damaging 0.70
IGL03120:Olr1 APN 6 129488935 missense probably damaging 0.97
IGL03237:Olr1 APN 6 129502154 missense probably damaging 1.00
ANU74:Olr1 UTSW 6 129500069 missense possibly damaging 0.91
R0112:Olr1 UTSW 6 129488906 missense possibly damaging 0.77
R1375:Olr1 UTSW 6 129507076 missense possibly damaging 0.94
R1650:Olr1 UTSW 6 129507089 missense probably benign 0.29
R1828:Olr1 UTSW 6 129488932 missense possibly damaging 0.94
R1971:Olr1 UTSW 6 129493535 missense probably benign 0.06
R2074:Olr1 UTSW 6 129502094 missense probably benign 0.23
R3110:Olr1 UTSW 6 129499918 missense possibly damaging 0.91
R3112:Olr1 UTSW 6 129499918 missense possibly damaging 0.91
R3735:Olr1 UTSW 6 129499875 unclassified probably benign
R3736:Olr1 UTSW 6 129499875 unclassified probably benign
R4200:Olr1 UTSW 6 129502105 missense probably damaging 0.98
R4780:Olr1 UTSW 6 129488876 missense probably damaging 0.99
R4801:Olr1 UTSW 6 129488090 missense possibly damaging 0.71
R4802:Olr1 UTSW 6 129488090 missense possibly damaging 0.71
R4856:Olr1 UTSW 6 129493596 nonsense probably null
R4929:Olr1 UTSW 6 129500081 missense probably damaging 1.00
R5148:Olr1 UTSW 6 129493609 missense probably benign 0.02
R5659:Olr1 UTSW 6 129500029 missense probably damaging 0.96
R6037:Olr1 UTSW 6 129493541 missense probably damaging 1.00
R6037:Olr1 UTSW 6 129493541 missense probably damaging 1.00
R6116:Olr1 UTSW 6 129499984 missense probably damaging 1.00
R6356:Olr1 UTSW 6 129493559 missense probably benign 0.22
R6676:Olr1 UTSW 6 129500077 splice site probably null
R7001:Olr1 UTSW 6 129488111 missense probably damaging 1.00
R7056:Olr1 UTSW 6 129488941 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTACGCCCATGAGAAGG -3'
(R):5'- AGCGAACCTTACTCAGCAG -3'

Sequencing Primer
(F):5'- AGCTTGAGCAATTCTGATGGTTAC -3'
(R):5'- GAACCTTACTCAGCAGGATCGTATC -3'
Posted On2019-06-07