Incidental Mutation 'PIT4618001:Scgb2b24'
ID555699
Institutional Source Beutler Lab
Gene Symbol Scgb2b24
Ensembl Gene ENSMUSG00000046438
Gene Namesecretoglobin, family 2B, member 24
SynonymsC2b, Abpbg24, Abpz, Scgb2b3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #PIT4618001 (G1)
Quality Score221.009
Status Not validated
Chromosome7
Chromosomal Location33737190-33739312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33738611 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 24 (C24S)
Ref Sequence ENSEMBL: ENSMUSP00000052456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055444]
Predicted Effect probably damaging
Transcript: ENSMUST00000055444
AA Change: C24S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052456
Gene: ENSMUSG00000046438
AA Change: C24S

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
Pfam:Feld-I_B 24 90 5.9e-33 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Scgb2b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Scgb2b24 APN 7 33739227 missense probably damaging 0.97
IGL02328:Scgb2b24 APN 7 33738625 splice site probably benign
R3441:Scgb2b24 UTSW 7 33738600 missense probably damaging 1.00
R5874:Scgb2b24 UTSW 7 33737405 missense probably damaging 0.99
R6572:Scgb2b24 UTSW 7 33738477 missense probably damaging 1.00
R6800:Scgb2b24 UTSW 7 33738469 missense probably benign 0.01
R7431:Scgb2b24 UTSW 7 33739249 missense probably benign 0.13
R8096:Scgb2b24 UTSW 7 33739221 splice site probably null
R8458:Scgb2b24 UTSW 7 33737354 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGGACATTACCAAAATTTGTGG -3'
(R):5'- TCTCTAAGTAGGGCATGAGACC -3'

Sequencing Primer
(F):5'- ACCAAAATTTGTGGTTCCAGTG -3'
(R):5'- GGGCATGAGACCGACCTAG -3'
Posted On2019-06-07