Incidental Mutation 'R0603:Mut'
ID55570
Institutional Source Beutler Lab
Gene Symbol Mut
Ensembl Gene ENSMUSG00000023921
Gene Namemethylmalonyl-Coenzyme A mutase
Synonyms
MMRRC Submission 038792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0603 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location40934685-40961989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40947166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 408 (I408F)
Ref Sequence ENSEMBL: ENSMUSP00000130941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169611]
Predicted Effect probably damaging
Transcript: ENSMUST00000169611
AA Change: I408F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: I408F

DomainStartEndE-ValueType
Pfam:MM_CoA_mutase 60 572 3.7e-240 PFAM
Pfam:B12-binding 613 731 4.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc7 A G 5: 122,440,170 N406S probably benign Het
Arhgap4 C T X: 73,906,783 R54Q probably damaging Het
Asb15 T A 6: 24,556,557 I17N probably damaging Het
Atp8a1 T C 5: 67,756,696 probably null Het
Caprin1 A G 2: 103,796,801 V47A probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Disp2 A G 2: 118,792,006 K1073R probably damaging Het
Dmxl2 G A 9: 54,405,906 H1686Y possibly damaging Het
Dzank1 C T 2: 144,511,512 V152I probably benign Het
Evl T A 12: 108,648,422 I25N probably damaging Het
Fam117a A G 11: 95,380,873 K424E probably damaging Het
Gm17732 C T 18: 62,662,752 probably benign Het
Gpr158 T C 2: 21,815,669 I659T possibly damaging Het
Hectd4 T A 5: 121,304,337 V1280E possibly damaging Het
Ikbkap A T 4: 56,792,105 I221N possibly damaging Het
Irs4 T C X: 141,725,075 T42A probably damaging Het
Kdm4a C T 4: 118,142,511 V905I probably damaging Het
Lmtk3 T A 7: 45,795,556 probably benign Het
Lsp1 G A 7: 142,489,378 R221H probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nckap1 A T 2: 80,512,729 V942E probably benign Het
Neto1 T A 18: 86,473,660 C229S possibly damaging Het
Nipal2 A G 15: 34,650,398 I63T probably damaging Het
Olfr1299 A T 2: 111,664,880 Y218F probably damaging Het
Olfr366 G A 2: 37,220,106 V206I probably damaging Het
Olfr58 A T 9: 19,783,939 R269W probably damaging Het
Olfr744 T C 14: 50,618,510 I96T probably damaging Het
Olfr957 C A 9: 39,511,514 V69F possibly damaging Het
Pgpep1 T C 8: 70,650,633 E120G probably benign Het
Pkhd1 A T 1: 20,117,173 M3637K probably benign Het
Pkm T C 9: 59,665,881 V58A probably damaging Het
Ppp2r1b C A 9: 50,861,685 T154K probably damaging Het
Rgs18 T A 1: 144,756,080 D98V possibly damaging Het
Rsph6a G T 7: 19,065,961 A506S possibly damaging Het
Selenop T A 15: 3,275,701 V113E probably damaging Het
Slc6a11 G A 6: 114,244,890 V514M probably benign Het
Srsf9 C T 5: 115,332,637 S132L probably damaging Het
Tchh G A 3: 93,443,781 R176H possibly damaging Het
Tcp11 T C 17: 28,067,810 N405S probably damaging Het
Tle1 A C 4: 72,118,347 D760E probably damaging Het
Tmem178 A G 17: 80,945,059 D124G possibly damaging Het
Trabd G A 15: 89,082,726 E118K probably damaging Het
Ttc39a A G 4: 109,426,302 D115G probably damaging Het
Uaca T A 9: 60,871,097 M920K possibly damaging Het
Uba2 A T 7: 34,161,613 M5K probably damaging Het
Unc5c C T 3: 141,771,102 P343L probably damaging Het
Wdhd1 T C 14: 47,263,586 D453G probably damaging Het
Wfdc8 A G 2: 164,603,225 Y157H probably damaging Het
Zbbx T G 3: 75,078,450 K432Q probably benign Het
Zeb2 G A 2: 45,017,426 T169M probably benign Het
Zfp956 A G 6: 47,956,028 E79G probably damaging Het
Zzef1 G A 11: 72,818,069 V165I probably benign Het
Other mutations in Mut
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Mut APN 17 40956271 missense probably damaging 0.99
IGL01666:Mut APN 17 40958811 missense probably damaging 1.00
IGL02141:Mut APN 17 40938817 missense possibly damaging 0.68
IGL02257:Mut APN 17 40938734 missense possibly damaging 0.78
IGL02538:Mut APN 17 40938619 missense probably damaging 1.00
mix UTSW 17 40941383 missense possibly damaging 0.66
mongrel UTSW 17 40938731 missense possibly damaging 0.77
R0115:Mut UTSW 17 40956227 missense probably damaging 1.00
R0381:Mut UTSW 17 40937258 missense probably benign 0.04
R0928:Mut UTSW 17 40937283 missense probably benign 0.24
R1292:Mut UTSW 17 40941407 missense probably damaging 1.00
R1452:Mut UTSW 17 40937468 splice site probably benign
R1460:Mut UTSW 17 40937375 missense probably damaging 1.00
R2044:Mut UTSW 17 40941451 missense probably benign 0.00
R2256:Mut UTSW 17 40956319 missense probably benign 0.02
R2448:Mut UTSW 17 40958841 missense probably damaging 0.96
R3113:Mut UTSW 17 40958356 missense probably damaging 1.00
R3176:Mut UTSW 17 40958872 splice site probably null
R3276:Mut UTSW 17 40958872 splice site probably null
R3894:Mut UTSW 17 40955139 missense probably damaging 0.97
R4624:Mut UTSW 17 40947055 missense probably damaging 1.00
R4801:Mut UTSW 17 40937351 missense probably benign 0.08
R4802:Mut UTSW 17 40937351 missense probably benign 0.08
R5031:Mut UTSW 17 40938827 missense possibly damaging 0.96
R5394:Mut UTSW 17 40947184 missense probably benign 0.02
R5651:Mut UTSW 17 40947111 missense probably damaging 1.00
R6225:Mut UTSW 17 40938731 missense possibly damaging 0.77
R6274:Mut UTSW 17 40956245 missense probably benign 0.00
R7002:Mut UTSW 17 40941383 missense possibly damaging 0.66
R7141:Mut UTSW 17 40952839 missense possibly damaging 0.68
R7203:Mut UTSW 17 40938673 missense probably benign 0.06
R7868:Mut UTSW 17 40947043 missense probably damaging 1.00
R8050:Mut UTSW 17 40943893 missense probably benign 0.06
R8228:Mut UTSW 17 40937328 missense possibly damaging 0.92
RF021:Mut UTSW 17 40951758 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTTGCTGACTAATTTGGCAGAGTTT -3'
(R):5'- GTGTGCATCTGTGTCTGCACCT -3'

Sequencing Primer
(F):5'- ACTCTGTTGCCTGTGAACG -3'
(R):5'- tgtgtctgtctgtctgtgtc -3'
Posted On2013-07-11