Incidental Mutation 'PIT4618001:Cemip'
ID555700
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #PIT4618001 (G1)
Quality Score84.0076
Status Not validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83943939 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1185 (F1185L)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably benign
Transcript: ENSMUST00000064174
AA Change: F1185L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: F1185L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
R7236:Cemip UTSW 7 83948804 splice site probably null
R7410:Cemip UTSW 7 83952834 missense probably damaging 1.00
R7483:Cemip UTSW 7 83998576 missense probably damaging 0.99
R7734:Cemip UTSW 7 83957664 nonsense probably null
R7924:Cemip UTSW 7 83943715 splice site probably benign
R7962:Cemip UTSW 7 84003408 start gained probably benign
R7988:Cemip UTSW 7 84003408 start gained probably benign
R7993:Cemip UTSW 7 83964175 missense probably damaging 1.00
R8005:Cemip UTSW 7 84003408 start gained probably benign
R8077:Cemip UTSW 7 84003408 start gained probably benign
R8130:Cemip UTSW 7 83947176 missense probably benign
R8131:Cemip UTSW 7 84003408 start gained probably benign
R8172:Cemip UTSW 7 83997225 missense probably damaging 1.00
R8220:Cemip UTSW 7 83947160 missense probably damaging 1.00
R8345:Cemip UTSW 7 83942165 critical splice acceptor site probably null
R8391:Cemip UTSW 7 83955309 missense probably damaging 0.99
RF008:Cemip UTSW 7 83961635 missense probably damaging 0.99
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Z1177:Cemip UTSW 7 83947296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACAGTTGTGAGGCTGTG -3'
(R):5'- GAATTGCCCTCATAAGAATACCCAG -3'

Sequencing Primer
(F):5'- AGGTCTGAGGGCTCTTCC -3'
(R):5'- AGATCCCTTCTGTGCACAGG -3'
Posted On2019-06-07