Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4618001:Cemip'

555700

Institutional Source

Beutler Lab

Gene Symbol

Cemip

Ensembl Gene

ENSMUSG00000052353

Gene Name

cell migration inducing protein, hyaluronan binding

Synonyms

6330404C01Rik, 9930013L23Rik, 12H19.01.T7

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

PIT4618001 (G1)

Quality Score

84.0076

Status

Not validated

Chromosome

Chromosomal Location

83932857-84086502 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83943939 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1185 (F1185L)

Ref Sequence

ENSEMBL: ENSMUSP00000063277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064174]

AlphaFold

Q8BI06

Predicted Effect

probably benign
Transcript: ENSMUST00000064174
AA Change: F1185L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: F1185L

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
G8	44	166	9.01e-42	SMART
Pfam:ILEI	187	281	2.1e-28	PFAM
Pfam:Mucin2_WxxW	324	403	1.2e-13	PFAM
PbH1	572	594	7.34e3	SMART
PbH1	595	617	3.73e3	SMART
PbH1	719	741	4.11e3	SMART
PbH1	798	819	6.96e2	SMART
Blast:PbH1	844	882	7e-17	BLAST
Blast:PbH1	917	952	2e-15	BLAST
Pfam:ILEI	1244	1334	2.7e-17	PFAM

Coding Region Coverage

1x: 93.4%
3x: 91.0%
10x: 85.9%
20x: 75.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,709	D64V	probably damaging	Het
Ankdd1a	A	C	9: 65,507,650	I268S	possibly damaging	Het
Atad3a	C	T	4: 155,750,138	R402Q	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Cd55	C	T	1: 130,456,869	V206I	probably benign	Het
Cd8a	A	G	6: 71,373,677	D42G	possibly damaging	Het
Cfap58	A	G	19: 47,975,514	D527G	probably damaging	Het
Cyp2a12	C	A	7: 27,034,773	S377Y	probably benign	Het
Dapk2	A	G	9: 66,268,686	D289G	probably benign	Het
Efcab6	G	A	15: 83,983,446	A277V	probably benign	Het
Ephx2	A	T	14: 66,102,222	F250L	probably damaging	Het
Flg2	A	T	3: 93,203,781	S1039C	unknown	Het
Gm609	A	G	16: 45,443,934	F87S	probably benign	Het
Gramd1a	A	G	7: 31,132,596	V674A	probably benign	Het
Gtf2a1	A	C	12: 91,567,769	V237G	probably benign	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Jagn1	T	A	6: 113,447,437	L90H	probably damaging	Het
Mdn1	G	T	4: 32,746,527	A4158S	probably benign	Het
Myh11	G	A	16: 14,201,066	A1839V		Het
Olr1	G	A	6: 129,499,906	A132V	probably damaging	Het
Paqr3	A	T	5: 97,103,471	H131Q	possibly damaging	Het
Pde4b	A	T	4: 102,602,812	T397S	probably benign	Het
Pon1	A	G	6: 5,168,349	C353R	probably damaging	Het
Ppie	G	A	4: 123,138,868	T43I	probably null	Het
Prr5l	A	G	2: 101,758,530	F92L	probably damaging	Het
Rai14	T	C	15: 10,575,156	Y601C	probably damaging	Het
Rasal1	A	G	5: 120,670,376	D491G	probably damaging	Het
Rbm12b1	T	A	4: 12,145,441	V471E	probably damaging	Het
Rpusd2	T	C	2: 119,038,452	L452P	possibly damaging	Het
Scgb2b24	A	T	7: 33,738,611	C24S	probably damaging	Het
Slc17a5	C	T	9: 78,538,248	V468M	possibly damaging	Het
Tcp10c	A	G	17: 13,356,510	K117R	possibly damaging	Het
Ubash3b	A	G	9: 41,016,627	S584P	probably benign	Het
Vps13b	C	T	15: 35,709,240	R1778C	probably damaging	Het
Ythdc2	A	G	18: 44,834,598	I220M	probably benign	Het
Zfp474	C	A	18: 52,638,404	T43K	probably damaging	Het
Zscan4-ps3	G	A	7: 11,613,334	M432I	probably benign	Het

Other mutations in Cemip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Cemip	APN	7	83947280	missense	possibly damaging	0.63
IGL01520:Cemip	APN	7	83948622	missense	probably benign	0.27
IGL01646:Cemip	APN	7	83983232	missense	possibly damaging	0.81
IGL02057:Cemip	APN	7	83987453	missense	probably damaging	1.00
IGL02058:Cemip	APN	7	83997292	missense	probably damaging	0.99
IGL02120:Cemip	APN	7	83951563	missense	probably damaging	0.99
IGL02278:Cemip	APN	7	83937438	missense	probably damaging	1.00
IGL02331:Cemip	APN	7	83963984	critical splice donor site	probably null
IGL02366:Cemip	APN	7	83943641	missense	probably benign	0.08
IGL02434:Cemip	APN	7	83955284	missense	probably damaging	0.98
IGL02622:Cemip	APN	7	83964175	missense	probably damaging	1.00
IGL02958:Cemip	APN	7	83975055	missense	probably damaging	0.99
IGL02979:Cemip	APN	7	84003306	splice site	probably benign
IGL03280:Cemip	APN	7	83987330	splice site	probably benign
IGL03400:Cemip	APN	7	83958516	missense	probably damaging	0.96
IGL03134:Cemip	UTSW	7	83999237	missense	probably damaging	1.00
R0149:Cemip	UTSW	7	83964010	missense	probably benign
R0212:Cemip	UTSW	7	83973190	missense	probably damaging	0.99
R0361:Cemip	UTSW	7	83964010	missense	probably benign
R0565:Cemip	UTSW	7	83964110	missense	probably damaging	0.99
R0727:Cemip	UTSW	7	83961578	missense	probably benign	0.00
R1342:Cemip	UTSW	7	83944075	nonsense	probably null
R1456:Cemip	UTSW	7	83998510	missense	possibly damaging	0.96
R1526:Cemip	UTSW	7	83951440	missense	probably damaging	1.00
R1676:Cemip	UTSW	7	83964038	missense	possibly damaging	0.77
R1718:Cemip	UTSW	7	83935658	missense	probably benign	0.00
R2234:Cemip	UTSW	7	83998562	missense	probably benign	0.02
R2513:Cemip	UTSW	7	83942025	missense	probably benign	0.11
R3788:Cemip	UTSW	7	83943898	missense	probably damaging	1.00
R3964:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R3966:Cemip	UTSW	7	83951509	missense	probably benign	0.43
R4436:Cemip	UTSW	7	83987429	missense	probably null	0.43
R4584:Cemip	UTSW	7	83958539	missense	probably damaging	1.00
R4601:Cemip	UTSW	7	83951618	missense	probably damaging	0.98
R4717:Cemip	UTSW	7	83947280	missense	probably damaging	0.97
R4767:Cemip	UTSW	7	83973306	missense	probably damaging	1.00
R4822:Cemip	UTSW	7	83973241	missense	probably benign	0.27
R4849:Cemip	UTSW	7	83935737	missense	possibly damaging	0.52
R4910:Cemip	UTSW	7	83997411	missense	probably damaging	1.00
R4911:Cemip	UTSW	7	83983253	missense	probably damaging	1.00
R4922:Cemip	UTSW	7	83947100	intron	probably benign
R4924:Cemip	UTSW	7	83952938	missense	probably damaging	1.00
R5090:Cemip	UTSW	7	83942135	missense	probably damaging	1.00
R5310:Cemip	UTSW	7	83992033	missense	probably damaging	1.00
R5327:Cemip	UTSW	7	83955301	missense	probably damaging	0.99
R5378:Cemip	UTSW	7	83958525	missense	probably damaging	1.00
R5444:Cemip	UTSW	7	83982291	missense	probably damaging	0.98
R5644:Cemip	UTSW	7	83989184	missense	probably benign	0.03
R5688:Cemip	UTSW	7	83961641	missense	probably damaging	1.00
R5714:Cemip	UTSW	7	83975179	missense	probably damaging	1.00
R6170:Cemip	UTSW	7	83947230	missense	possibly damaging	0.89
R6505:Cemip	UTSW	7	83951597	nonsense	probably null
R6713:Cemip	UTSW	7	83943637	missense	probably benign	0.03
R6767:Cemip	UTSW	7	83998624	missense	probably damaging	1.00
R6817:Cemip	UTSW	7	83987992	missense	probably damaging	1.00
R6896:Cemip	UTSW	7	83998576	missense	probably damaging	1.00
R6945:Cemip	UTSW	7	83998547	missense	probably damaging	1.00
R7236:Cemip	UTSW	7	83948804	splice site	probably null
R7410:Cemip	UTSW	7	83952834	missense	probably damaging	1.00
R7483:Cemip	UTSW	7	83998576	missense	probably damaging	0.99
R7734:Cemip	UTSW	7	83957664	nonsense	probably null
R7924:Cemip	UTSW	7	83943715	splice site	probably benign
R7962:Cemip	UTSW	7	84003408	start gained	probably benign
R7988:Cemip	UTSW	7	84003408	start gained	probably benign
R7993:Cemip	UTSW	7	83964175	missense	probably damaging	1.00
R8005:Cemip	UTSW	7	84003408	start gained	probably benign
R8077:Cemip	UTSW	7	84003408	start gained	probably benign
R8130:Cemip	UTSW	7	83947176	missense	probably benign
R8131:Cemip	UTSW	7	84003408	start gained	probably benign
R8172:Cemip	UTSW	7	83997225	missense	probably damaging	1.00
R8220:Cemip	UTSW	7	83947160	missense	probably damaging	1.00
R8345:Cemip	UTSW	7	83942165	critical splice acceptor site	probably null
R8391:Cemip	UTSW	7	83955309	missense	probably damaging	0.99
R8492:Cemip	UTSW	7	83973214	missense	probably damaging	0.99
R8496:Cemip	UTSW	7	83951426	missense	probably benign	0.00
R8698:Cemip	UTSW	7	83958582	missense	probably damaging	0.98
R8835:Cemip	UTSW	7	83937443	missense	probably damaging	1.00
R9229:Cemip	UTSW	7	83957625	missense	probably damaging	1.00
RF008:Cemip	UTSW	7	83961635	missense	probably damaging	0.99
T0970:Cemip	UTSW	7	83983146	missense	probably damaging	0.99
X0067:Cemip	UTSW	7	83947208	missense	probably damaging	0.98
Z1177:Cemip	UTSW	7	83947296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACAGTTGTGAGGCTGTG -3'
(R):5'- GAATTGCCCTCATAAGAATACCCAG -3'

Sequencing Primer
(F):5'- AGGTCTGAGGGCTCTTCC -3'
(R):5'- AGATCCCTTCTGTGCACAGG -3'

Posted On

2019-06-07