Incidental Mutation 'PIT4618001:Ubash3b'
ID555701
Institutional Source Beutler Lab
Gene Symbol Ubash3b
Ensembl Gene ENSMUSG00000032020
Gene Nameubiquitin associated and SH3 domain containing, B
Synonyms2810457I06Rik, TULA-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location41011098-41161697 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41016627 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 584 (S584P)
Ref Sequence ENSEMBL: ENSMUSP00000043865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044155] [ENSMUST00000151485]
PDB Structure
Crystal Structure of the PGM domain of the Suppressor of T-Cell receptor (Sts-1) [X-RAY DIFFRACTION]
Crystal structure of mouse Sts-1 PGM domain in complex with phosphate [X-RAY DIFFRACTION]
The 1.35 A Structure of the Phosphatase Domain of the Suppressor of T Cell Receptor Signalling Protein in Complex with Sulphate [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000044155
AA Change: S584P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043865
Gene: ENSMUSG00000032020
AA Change: S584P

DomainStartEndE-ValueType
UBA 26 64 2.43e-4 SMART
low complexity region 177 186 N/A INTRINSIC
SH3 246 307 7.29e-10 SMART
Pfam:His_Phos_1 415 598 3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151485
AA Change: S462P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116038
Gene: ENSMUSG00000032020
AA Change: S462P

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
SH3 124 185 7.29e-10 SMART
Pfam:His_Phos_1 252 450 1.9e-27 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, developmentally normal, and do not display any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Ubash3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ubash3b APN 9 41018015 critical splice donor site probably null
IGL01734:Ubash3b APN 9 41026247 splice site probably benign
IGL02311:Ubash3b APN 9 41047037 missense probably benign
IGL03406:Ubash3b APN 9 41037479 missense probably damaging 1.00
PIT4687001:Ubash3b UTSW 9 41023518 missense probably damaging 1.00
R0524:Ubash3b UTSW 9 41016608 missense probably benign 0.16
R0666:Ubash3b UTSW 9 41047064 missense possibly damaging 0.67
R0927:Ubash3b UTSW 9 41023557 nonsense probably null
R1112:Ubash3b UTSW 9 41028116 missense probably damaging 1.00
R1544:Ubash3b UTSW 9 41016605 missense probably damaging 1.00
R1596:Ubash3b UTSW 9 41031497 missense probably benign
R1610:Ubash3b UTSW 9 41043500 missense probably damaging 1.00
R2069:Ubash3b UTSW 9 41043573 missense possibly damaging 0.82
R2507:Ubash3b UTSW 9 41157354 missense possibly damaging 0.90
R2520:Ubash3b UTSW 9 41014947 missense probably damaging 1.00
R3899:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R3900:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R4715:Ubash3b UTSW 9 41016600 missense probably damaging 1.00
R4876:Ubash3b UTSW 9 41018109 missense probably benign 0.00
R5023:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5034:Ubash3b UTSW 9 41029740 missense probably benign 0.25
R5057:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5396:Ubash3b UTSW 9 41043473 critical splice donor site probably null
R5448:Ubash3b UTSW 9 41037435 critical splice donor site probably null
R5760:Ubash3b UTSW 9 41077423 missense probably benign 0.00
R6178:Ubash3b UTSW 9 41014916 missense probably damaging 0.96
R6392:Ubash3b UTSW 9 41014972 missense probably damaging 1.00
R8115:Ubash3b UTSW 9 41026328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGAACACATCTTGGCTG -3'
(R):5'- GTAGATTCTCCTGCCCTACATTGAC -3'

Sequencing Primer
(F):5'- CACTGAACACATCTTGGCTGAGTTG -3'
(R):5'- GTTGCAGTGTCCAGGACCAAAC -3'
Posted On2019-06-07