Incidental Mutation 'PIT4618001:Ankdd1a'
ID555702
Institutional Source Beutler Lab
Gene Symbol Ankdd1a
Ensembl Gene ENSMUSG00000066510
Gene Nameankyrin repeat and death domain containing 1A
SynonymsLOC384945
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location65488470-65520193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65507650 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 268 (I268S)
Ref Sequence ENSEMBL: ENSMUSP00000150130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061766] [ENSMUST00000217646]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061766
AA Change: I258S

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057040
Gene: ENSMUSG00000066510
AA Change: I258S

DomainStartEndE-ValueType
ANK 4 33 1.31e3 SMART
ANK 37 66 2.1e-3 SMART
ANK 70 99 6.26e-2 SMART
ANK 103 132 8.72e-1 SMART
ANK 138 167 5.09e-2 SMART
ANK 171 200 4.03e-5 SMART
ANK 204 233 5.32e-5 SMART
ANK 237 268 8.72e-1 SMART
ANK 270 299 8.99e-3 SMART
ANK 303 332 1.23e0 SMART
ANK 336 364 1.4e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217646
AA Change: I268S

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Ankdd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Ankdd1a APN 9 65508702 missense probably damaging 1.00
IGL01372:Ankdd1a APN 9 65504139 missense probably damaging 1.00
IGL01932:Ankdd1a APN 9 65507611 splice site probably benign
IGL02150:Ankdd1a APN 9 65512719 missense probably damaging 1.00
IGL03243:Ankdd1a APN 9 65501470 missense probably benign 0.28
R0137:Ankdd1a UTSW 9 65510328 missense probably null 0.26
R0302:Ankdd1a UTSW 9 65509642 splice site probably benign
R0980:Ankdd1a UTSW 9 65516971 missense probably damaging 1.00
R1832:Ankdd1a UTSW 9 65504489 critical splice donor site probably null
R3887:Ankdd1a UTSW 9 65502248 missense probably damaging 1.00
R4470:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R4471:Ankdd1a UTSW 9 65503509 missense probably damaging 1.00
R5326:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5394:Ankdd1a UTSW 9 65505214 missense probably benign 0.12
R5542:Ankdd1a UTSW 9 65504190 critical splice acceptor site probably null
R5594:Ankdd1a UTSW 9 65502241 missense probably damaging 1.00
R5933:Ankdd1a UTSW 9 65509696 missense probably benign 0.11
R6217:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6294:Ankdd1a UTSW 9 65520164 missense probably benign 0.12
R6300:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6301:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6305:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6306:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6307:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6312:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6313:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6314:Ankdd1a UTSW 9 65508061 missense possibly damaging 0.85
R6413:Ankdd1a UTSW 9 65510372 missense probably benign
R6431:Ankdd1a UTSW 9 65516938 missense possibly damaging 0.92
R6477:Ankdd1a UTSW 9 65502212 missense probably benign 0.10
R6991:Ankdd1a UTSW 9 65508675 missense probably benign 0.22
R7260:Ankdd1a UTSW 9 65504552 missense probably damaging 0.96
R7586:Ankdd1a UTSW 9 65502184 critical splice donor site probably null
X0064:Ankdd1a UTSW 9 65503453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCTCCCGACAAAGATCAG -3'
(R):5'- TTTGCAAATCACGAGGCCTGG -3'

Sequencing Primer
(F):5'- CATGATAATGCCACTATTCCTTCAG -3'
(R):5'- GGCCTGGGCAAATCACAGATTTC -3'
Posted On2019-06-07