Incidental Mutation 'PIT4618001:Dapk2'
ID555703
Institutional Source Beutler Lab
Gene Symbol Dapk2
Ensembl Gene ENSMUSG00000032380
Gene Namedeath-associated protein kinase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location66158223-66272242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66268686 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 289 (D289G)
Ref Sequence ENSEMBL: ENSMUSP00000034944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034944]
PDB Structure
CRYSTAL STRUCTURE OF THE AUTOINHIBITED FORM OF MOUSE DAPK2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AUTOINHIBITED FORM OF MOUSE DAPK2 IN COMPLEX WITH ATP [X-RAY DIFFRACTION]
Crystal structure of the autoinhibited form of mouse DAPK2 in complex with AMP [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034944
AA Change: D289G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034944
Gene: ENSMUSG00000032380
AA Change: D289G

DomainStartEndE-ValueType
S_TKc 23 285 6.26e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132987
SMART Domains Protein: ENSMUSP00000117134
Gene: ENSMUSG00000032380

DomainStartEndE-ValueType
Pfam:Pkinase 1 52 2e-14 PFAM
Pfam:Pkinase_Tyr 1 53 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family. This protein contains a N-terminal protein kinase domain followed by a conserved calmodulin-binding domain with significant similarity to that of death-associated protein kinase 1 (DAPK1), a positive regulator of programmed cell death. Overexpression of this gene was shown to induce cell apoptosis. It uses multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Dapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Dapk2 APN 9 66268778 splice site probably benign
IGL01304:Dapk2 APN 9 66231857 splice site probably benign
IGL02053:Dapk2 APN 9 66220745 missense probably benign 0.02
IGL02351:Dapk2 APN 9 66246523 missense probably damaging 0.99
IGL02358:Dapk2 APN 9 66246523 missense probably damaging 0.99
IGL02736:Dapk2 APN 9 66268916 missense probably benign
IGL02742:Dapk2 APN 9 66231814 missense probably damaging 1.00
R0367:Dapk2 UTSW 9 66268886 missense probably damaging 0.99
R1375:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1376:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1376:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1752:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1924:Dapk2 UTSW 9 66165360 missense probably benign 0.05
R1981:Dapk2 UTSW 9 66268898 missense probably benign 0.00
R3160:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3161:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3162:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3162:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R5394:Dapk2 UTSW 9 66268718 missense probably benign 0.00
R6750:Dapk2 UTSW 9 66220752 missense probably damaging 1.00
R6951:Dapk2 UTSW 9 66254622 missense probably benign 0.01
R6952:Dapk2 UTSW 9 66254622 missense probably benign 0.01
R6953:Dapk2 UTSW 9 66254622 missense probably benign 0.01
R8304:Dapk2 UTSW 9 66231745 missense possibly damaging 0.55
Z1088:Dapk2 UTSW 9 66246477 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTCAGGATACCTTCTGGGCAG -3'
(R):5'- TTGCACAAGGAGACGATGCTG -3'

Sequencing Primer
(F):5'- GCAGCGAGACATTTGTAGCTTCC -3'
(R):5'- CAAGGAGACGATGCTGAAGGAC -3'
Posted On2019-06-07