Incidental Mutation 'PIT4618001:Slc17a5'
ID555704
Institutional Source Beutler Lab
Gene Symbol Slc17a5
Ensembl Gene ENSMUSG00000049624
Gene Namesolute carrier family 17 (anion/sugar transporter), member 5
Synonyms4631416G20Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location78536488-78588041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78538248 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 468 (V468M)
Ref Sequence ENSEMBL: ENSMUSP00000056182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052441] [ENSMUST00000117645]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052441
AA Change: V468M

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056182
Gene: ENSMUSG00000049624
AA Change: V468M

DomainStartEndE-ValueType
Pfam:MFS_1 46 441 1.8e-61 PFAM
transmembrane domain 456 478 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117645
AA Change: V442M

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113003
Gene: ENSMUSG00000049624
AA Change: V442M

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
Pfam:MFS_1 97 415 2.5e-50 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane transporter that exports free sialic acids that have been cleaved off of cell surface lipids and proteins from lysosomes. Mutations in this gene cause sialic acid storage diseases, including infantile sialic acid storage disorder and and Salla disease, an adult form. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit numerous neurological abnormalities, including impaired exploratory and locomotor activity, hearing deficits, and an increased depressive-like response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Slc17a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc17a5 APN 9 78578534 missense probably benign
IGL00828:Slc17a5 APN 9 78578551 missense probably benign 0.37
IGL01603:Slc17a5 APN 9 78574707 missense probably damaging 1.00
IGL01945:Slc17a5 APN 9 78587932 missense probably benign 0.01
IGL03250:Slc17a5 APN 9 78578564 missense probably damaging 0.99
R0136:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0245:Slc17a5 UTSW 9 78540924 missense probably benign 0.00
R0305:Slc17a5 UTSW 9 78557537 missense probably benign 0.25
R0481:Slc17a5 UTSW 9 78538302 splice site probably null
R0657:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0763:Slc17a5 UTSW 9 78553090 splice site probably benign
R1543:Slc17a5 UTSW 9 78560800 missense probably benign 0.01
R1564:Slc17a5 UTSW 9 78578699 missense probably damaging 0.98
R2155:Slc17a5 UTSW 9 78577173 missense probably damaging 1.00
R2483:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R3623:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R4193:Slc17a5 UTSW 9 78559106 missense possibly damaging 0.58
R4794:Slc17a5 UTSW 9 78574715 missense probably damaging 0.96
R5115:Slc17a5 UTSW 9 78577112 missense probably benign 0.12
R5141:Slc17a5 UTSW 9 78540988 missense probably damaging 1.00
R5205:Slc17a5 UTSW 9 78578617 missense probably damaging 1.00
R5953:Slc17a5 UTSW 9 78557498 missense probably damaging 1.00
R6481:Slc17a5 UTSW 9 78538271 missense possibly damaging 0.87
R7375:Slc17a5 UTSW 9 78587892 missense probably benign 0.00
R8309:Slc17a5 UTSW 9 78571029 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTCTCACATAGAATGCTTGCAC -3'
(R):5'- CCTGTCATGGAGCAGAACAC -3'

Sequencing Primer
(F):5'- TGCTTGCACATTCAAATACCAAAGG -3'
(R):5'- GCTGGACTGAAGAATCTCTCCTCAG -3'
Posted On2019-06-07