Incidental Mutation 'PIT4618001:Ephx2'
ID555706
Institutional Source Beutler Lab
Gene Symbol Ephx2
Ensembl Gene ENSMUSG00000022040
Gene Nameepoxide hydrolase 2, cytoplasmic
SynonymsEph2, sEP, sEH
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location66084374-66124500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66102222 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 250 (F250L)
Ref Sequence ENSEMBL: ENSMUSP00000069209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070515] [ENSMUST00000224698] [ENSMUST00000225309]
PDB Structure CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CPU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CIU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CDU INHIBITOR [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000070515
AA Change: F250L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069209
Gene: ENSMUSG00000022040
AA Change: F250L

DomainStartEndE-ValueType
Pfam:Hydrolase 3 197 1.2e-8 PFAM
Pfam:HAD_2 6 203 2.5e-17 PFAM
Pfam:Hydrolase_4 256 529 6.6e-11 PFAM
Pfam:Abhydrolase_1 257 530 7.2e-38 PFAM
Pfam:Abhydrolase_5 258 524 3.5e-14 PFAM
Pfam:Abhydrolase_6 259 536 2.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224698
AA Change: F232L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225309
AA Change: F184L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Males homozygous for a targeted null mutation display a significant reduction in blood pressure both in the absence and presence of dietary salt loading. Both sexes exhibit altered arachidonic acid metabolism and reduced renal formation of epoxyeicosatrienoic and dihydroxyeicosatrienoic acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Ephx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ephx2 APN 14 66092837 missense probably benign
IGL01143:Ephx2 APN 14 66089522 missense probably damaging 1.00
IGL02058:Ephx2 APN 14 66103724 critical splice donor site probably null
IGL02164:Ephx2 APN 14 66103720 splice site probably benign
IGL02606:Ephx2 APN 14 66086292 missense probably damaging 1.00
R0396:Ephx2 UTSW 14 66108063 missense probably benign 0.03
R0732:Ephx2 UTSW 14 66086963 critical splice donor site probably null
R0762:Ephx2 UTSW 14 66102179 missense probably damaging 1.00
R1444:Ephx2 UTSW 14 66107320 missense probably damaging 1.00
R1689:Ephx2 UTSW 14 66087026 nonsense probably null
R1735:Ephx2 UTSW 14 66088303 missense probably benign
R1871:Ephx2 UTSW 14 66084734 missense probably damaging 1.00
R4210:Ephx2 UTSW 14 66084944 missense probably damaging 1.00
R5130:Ephx2 UTSW 14 66108062 missense probably damaging 0.97
R5800:Ephx2 UTSW 14 66107302 missense probably benign 0.38
R6013:Ephx2 UTSW 14 66110242 missense probably benign 0.19
R6076:Ephx2 UTSW 14 66092848 missense probably damaging 1.00
R6193:Ephx2 UTSW 14 66089512 missense probably benign 0.01
R6193:Ephx2 UTSW 14 66112220 missense probably benign 0.12
R7324:Ephx2 UTSW 14 66085354 missense probably damaging 1.00
R7390:Ephx2 UTSW 14 66110455
R7504:Ephx2 UTSW 14 66101617 missense probably damaging 0.99
R7759:Ephx2 UTSW 14 66089519 missense possibly damaging 0.67
R7814:Ephx2 UTSW 14 66110229 missense probably benign 0.09
R7863:Ephx2 UTSW 14 66107243 nonsense probably null
R8003:Ephx2 UTSW 14 66124333 critical splice donor site probably null
R8157:Ephx2 UTSW 14 66108057 missense probably damaging 1.00
R8169:Ephx2 UTSW 14 66112153 splice site probably null
RF023:Ephx2 UTSW 14 66084929 critical splice donor site probably null
Z1088:Ephx2 UTSW 14 66107318 missense probably benign 0.00
Z1177:Ephx2 UTSW 14 66085325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACCTTCTAATGCAGATGTC -3'
(R):5'- CCAGCCATTTAACCTTTGGGTC -3'

Sequencing Primer
(F):5'- GTCTTGAGAGTCAATACAGCTCC -3'
(R):5'- AGCCATTTAACCTTTGGGTCTTTGAG -3'
Posted On2019-06-07