Incidental Mutation 'PIT4618001:Rai14'
ID 555707
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Name retinoic acid induced 14
Synonyms 1700020L11Rik, Ankycorbin, 1700008J19Rik, Norpeg
Accession Numbers
Essential gene? Possibly essential (E-score: 0.654) question?
Stock # PIT4618001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 10569055-10714710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10575242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 601 (Y601C)
Ref Sequence ENSEMBL: ENSMUSP00000087815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
AlphaFold Q9EP71
Predicted Effect probably damaging
Transcript: ENSMUST00000090339
AA Change: Y601C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: Y601C

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169385
AA Change: Y601C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: Y601C

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227506
AA Change: Y572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,693,575 (GRCm39) D64V probably damaging Het
Ankdd1a A C 9: 65,414,932 (GRCm39) I268S possibly damaging Het
Atad3a C T 4: 155,834,595 (GRCm39) R402Q probably benign Het
C3ar1 A G 6: 122,827,746 (GRCm39) V157A probably benign Het
Cd200l1 A G 16: 45,264,297 (GRCm39) F87S probably benign Het
Cd55 C T 1: 130,384,606 (GRCm39) V206I probably benign Het
Cd8a A G 6: 71,350,661 (GRCm39) D42G possibly damaging Het
Cemip G T 7: 83,593,147 (GRCm39) F1185L probably benign Het
Cfap58 A G 19: 47,963,953 (GRCm39) D527G probably damaging Het
Cyp2a12 C A 7: 26,734,198 (GRCm39) S377Y probably benign Het
Dapk2 A G 9: 66,175,968 (GRCm39) D289G probably benign Het
Efcab6 G A 15: 83,867,647 (GRCm39) A277V probably benign Het
Ephx2 A T 14: 66,339,671 (GRCm39) F250L probably damaging Het
Flg2 A T 3: 93,111,088 (GRCm39) S1039C unknown Het
Gramd1a A G 7: 30,832,021 (GRCm39) V674A probably benign Het
Gtf2a1 A C 12: 91,534,543 (GRCm39) V237G probably benign Het
I830077J02Rik G A 3: 105,833,886 (GRCm39) T90M probably damaging Het
Jagn1 T A 6: 113,424,398 (GRCm39) L90H probably damaging Het
Mdn1 G T 4: 32,746,527 (GRCm39) A4158S probably benign Het
Myh11 G A 16: 14,018,930 (GRCm39) A1839V Het
Olr1 G A 6: 129,476,869 (GRCm39) A132V probably damaging Het
Paqr3 A T 5: 97,251,330 (GRCm39) H131Q possibly damaging Het
Pde4b A T 4: 102,460,009 (GRCm39) T397S probably benign Het
Pon1 A G 6: 5,168,349 (GRCm39) C353R probably damaging Het
Ppie G A 4: 123,032,661 (GRCm39) T43I probably null Het
Prr5l A G 2: 101,588,875 (GRCm39) F92L probably damaging Het
Rasal1 A G 5: 120,808,441 (GRCm39) D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 (GRCm39) V471E probably damaging Het
Rpusd2 T C 2: 118,868,933 (GRCm39) L452P possibly damaging Het
Scgb2b24 A T 7: 33,438,036 (GRCm39) C24S probably damaging Het
Slc17a5 C T 9: 78,445,530 (GRCm39) V468M possibly damaging Het
Tcp10c A G 17: 13,576,772 (GRCm39) K117R possibly damaging Het
Ubash3b A G 9: 40,927,923 (GRCm39) S584P probably benign Het
Vps13b C T 15: 35,709,386 (GRCm39) R1778C probably damaging Het
Ythdc2 A G 18: 44,967,665 (GRCm39) I220M probably benign Het
Zfp474 C A 18: 52,771,476 (GRCm39) T43K probably damaging Het
Zscan4-ps3 G A 7: 11,347,261 (GRCm39) M432I probably benign Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10,599,797 (GRCm39) splice site probably benign
IGL01625:Rai14 APN 15 10,572,460 (GRCm39) missense probably benign 0.30
IGL01925:Rai14 APN 15 10,595,948 (GRCm39) missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10,633,242 (GRCm39) missense probably benign 0.00
IGL02531:Rai14 APN 15 10,574,868 (GRCm39) missense probably damaging 1.00
IGL02748:Rai14 APN 15 10,589,421 (GRCm39) missense probably benign 0.14
IGL02945:Rai14 APN 15 10,574,795 (GRCm39) missense probably benign 0.00
R1400:Rai14 UTSW 15 10,571,634 (GRCm39) missense probably damaging 0.98
R1583:Rai14 UTSW 15 10,588,002 (GRCm39) missense probably damaging 1.00
R1686:Rai14 UTSW 15 10,592,282 (GRCm39) missense probably damaging 0.98
R1721:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1867:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1868:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1998:Rai14 UTSW 15 10,595,067 (GRCm39) splice site probably null
R2118:Rai14 UTSW 15 10,575,252 (GRCm39) missense probably benign 0.00
R3161:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10,592,298 (GRCm39) missense probably benign 0.30
R4611:Rai14 UTSW 15 10,592,224 (GRCm39) missense probably damaging 1.00
R4760:Rai14 UTSW 15 10,575,776 (GRCm39) missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10,572,556 (GRCm39) missense probably damaging 0.99
R5022:Rai14 UTSW 15 10,574,592 (GRCm39) missense probably damaging 0.96
R5110:Rai14 UTSW 15 10,690,496 (GRCm39) start gained probably benign
R5410:Rai14 UTSW 15 10,575,024 (GRCm39) missense probably damaging 1.00
R5643:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5644:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5681:Rai14 UTSW 15 10,575,206 (GRCm39) missense probably damaging 1.00
R5934:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably damaging 0.98
R6333:Rai14 UTSW 15 10,575,022 (GRCm39) nonsense probably null
R6338:Rai14 UTSW 15 10,575,062 (GRCm39) missense probably damaging 1.00
R6864:Rai14 UTSW 15 10,633,254 (GRCm39) missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10,589,401 (GRCm39) nonsense probably null
R7155:Rai14 UTSW 15 10,595,089 (GRCm39) missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10,571,622 (GRCm39) missense probably benign 0.02
R7574:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,574,914 (GRCm39) missense probably benign
R7597:Rai14 UTSW 15 10,574,937 (GRCm39) missense possibly damaging 0.94
R7658:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7779:Rai14 UTSW 15 10,593,112 (GRCm39) missense probably damaging 1.00
R7946:Rai14 UTSW 15 10,574,287 (GRCm39) splice site probably null
R8171:Rai14 UTSW 15 10,633,249 (GRCm39) missense probably damaging 1.00
R8195:Rai14 UTSW 15 10,575,302 (GRCm39) missense probably benign
R8471:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably benign 0.01
R8485:Rai14 UTSW 15 10,575,122 (GRCm39) missense probably damaging 1.00
R9075:Rai14 UTSW 15 10,589,403 (GRCm39) missense probably damaging 1.00
R9287:Rai14 UTSW 15 10,592,204 (GRCm39) missense probably benign 0.14
R9502:Rai14 UTSW 15 10,587,947 (GRCm39) missense possibly damaging 0.50
R9603:Rai14 UTSW 15 10,595,116 (GRCm39) nonsense probably null
R9665:Rai14 UTSW 15 10,574,803 (GRCm39) missense probably damaging 1.00
R9767:Rai14 UTSW 15 10,610,127 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTCGGCTGCATCTTCCAG -3'
(R):5'- ATGAAGCTGGGTCTCCTCTC -3'

Sequencing Primer
(F):5'- GGCTGCATCTTCCAGAGATTTC -3'
(R):5'- GATGGCTACTCGCATCTCCG -3'
Posted On 2019-06-07