Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4618001:Rai14'

555707

Institutional Source

Beutler Lab

Gene Symbol

Rai14

Ensembl Gene

ENSMUSG00000022246

Gene Name

retinoic acid induced 14

Synonyms

1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.537) question?

Stock #

PIT4618001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10568969-10714624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10575156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 601 (Y601C)

Ref Sequence

ENSEMBL: ENSMUSP00000087815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]

AlphaFold

Q9EP71

Predicted Effect

probably damaging
Transcript: ENSMUST00000090339
AA Change: Y601C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: Y601C

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000169385
AA Change: Y601C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: Y601C

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000227506
AA Change: Y572C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 93.4%
3x: 91.0%
10x: 85.9%
20x: 75.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,709	D64V	probably damaging	Het
Ankdd1a	A	C	9: 65,507,650	I268S	possibly damaging	Het
Atad3a	C	T	4: 155,750,138	R402Q	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Cd55	C	T	1: 130,456,869	V206I	probably benign	Het
Cd8a	A	G	6: 71,373,677	D42G	possibly damaging	Het
Cemip	G	T	7: 83,943,939	F1185L	probably benign	Het
Cfap58	A	G	19: 47,975,514	D527G	probably damaging	Het
Cyp2a12	C	A	7: 27,034,773	S377Y	probably benign	Het
Dapk2	A	G	9: 66,268,686	D289G	probably benign	Het
Efcab6	G	A	15: 83,983,446	A277V	probably benign	Het
Ephx2	A	T	14: 66,102,222	F250L	probably damaging	Het
Flg2	A	T	3: 93,203,781	S1039C	unknown	Het
Gm609	A	G	16: 45,443,934	F87S	probably benign	Het
Gramd1a	A	G	7: 31,132,596	V674A	probably benign	Het
Gtf2a1	A	C	12: 91,567,769	V237G	probably benign	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Jagn1	T	A	6: 113,447,437	L90H	probably damaging	Het
Mdn1	G	T	4: 32,746,527	A4158S	probably benign	Het
Myh11	G	A	16: 14,201,066	A1839V		Het
Olr1	G	A	6: 129,499,906	A132V	probably damaging	Het
Paqr3	A	T	5: 97,103,471	H131Q	possibly damaging	Het
Pde4b	A	T	4: 102,602,812	T397S	probably benign	Het
Pon1	A	G	6: 5,168,349	C353R	probably damaging	Het
Ppie	G	A	4: 123,138,868	T43I	probably null	Het
Prr5l	A	G	2: 101,758,530	F92L	probably damaging	Het
Rasal1	A	G	5: 120,670,376	D491G	probably damaging	Het
Rbm12b1	T	A	4: 12,145,441	V471E	probably damaging	Het
Rpusd2	T	C	2: 119,038,452	L452P	possibly damaging	Het
Scgb2b24	A	T	7: 33,738,611	C24S	probably damaging	Het
Slc17a5	C	T	9: 78,538,248	V468M	possibly damaging	Het
Tcp10c	A	G	17: 13,356,510	K117R	possibly damaging	Het
Ubash3b	A	G	9: 41,016,627	S584P	probably benign	Het
Vps13b	C	T	15: 35,709,240	R1778C	probably damaging	Het
Ythdc2	A	G	18: 44,834,598	I220M	probably benign	Het
Zfp474	C	A	18: 52,638,404	T43K	probably damaging	Het
Zscan4-ps3	G	A	7: 11,613,334	M432I	probably benign	Het

Other mutations in Rai14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Rai14	APN	15	10599711	splice site	probably benign
IGL01625:Rai14	APN	15	10572374	missense	probably benign	0.30
IGL01925:Rai14	APN	15	10595862	missense	possibly damaging	0.88
IGL02053:Rai14	APN	15	10633156	missense	probably benign	0.00
IGL02531:Rai14	APN	15	10574782	missense	probably damaging	1.00
IGL02748:Rai14	APN	15	10589335	missense	probably benign	0.14
IGL02945:Rai14	APN	15	10574709	missense	probably benign	0.00
R1400:Rai14	UTSW	15	10571548	missense	probably damaging	0.98
R1583:Rai14	UTSW	15	10587916	missense	probably damaging	1.00
R1686:Rai14	UTSW	15	10592196	missense	probably damaging	0.98
R1721:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1867:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1868:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1998:Rai14	UTSW	15	10594981	splice site	probably null
R2118:Rai14	UTSW	15	10575166	missense	probably benign	0.00
R3161:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R4049:Rai14	UTSW	15	10592212	missense	probably benign	0.30
R4611:Rai14	UTSW	15	10592138	missense	probably damaging	1.00
R4760:Rai14	UTSW	15	10575690	missense	possibly damaging	0.60
R4863:Rai14	UTSW	15	10572470	missense	probably damaging	0.99
R5022:Rai14	UTSW	15	10574506	missense	probably damaging	0.96
R5110:Rai14	UTSW	15	10690410	start gained	probably benign
R5410:Rai14	UTSW	15	10574938	missense	probably damaging	1.00
R5643:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5644:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5681:Rai14	UTSW	15	10575120	missense	probably damaging	1.00
R5934:Rai14	UTSW	15	10575159	missense	probably damaging	0.98
R6333:Rai14	UTSW	15	10574936	nonsense	probably null
R6338:Rai14	UTSW	15	10574976	missense	probably damaging	1.00
R6864:Rai14	UTSW	15	10633168	missense	possibly damaging	0.95
R7015:Rai14	UTSW	15	10589315	nonsense	probably null
R7155:Rai14	UTSW	15	10595003	missense	possibly damaging	0.53
R7480:Rai14	UTSW	15	10571536	missense	probably benign	0.02
R7574:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10574828	missense	probably benign
R7578:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7597:Rai14	UTSW	15	10574851	missense	possibly damaging	0.94
R7658:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7779:Rai14	UTSW	15	10593026	missense	probably damaging	1.00
R7946:Rai14	UTSW	15	10574201	splice site	probably null
R8171:Rai14	UTSW	15	10633163	missense	probably damaging	1.00
R8195:Rai14	UTSW	15	10575216	missense	probably benign
R8471:Rai14	UTSW	15	10575159	missense	probably benign	0.01
R8485:Rai14	UTSW	15	10575036	missense	probably damaging	1.00
R9075:Rai14	UTSW	15	10589317	missense	probably damaging	1.00
R9287:Rai14	UTSW	15	10592118	missense	probably benign	0.14
R9502:Rai14	UTSW	15	10587861	missense	possibly damaging	0.50
R9603:Rai14	UTSW	15	10595030	nonsense	probably null
R9665:Rai14	UTSW	15	10574717	missense	probably damaging	1.00
R9767:Rai14	UTSW	15	10610041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TACTCGGCTGCATCTTCCAG -3'
(R):5'- ATGAAGCTGGGTCTCCTCTC -3'

Sequencing Primer
(F):5'- GGCTGCATCTTCCAGAGATTTC -3'
(R):5'- GATGGCTACTCGCATCTCCG -3'

Posted On

2019-06-07