Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4618001:Myh11'

555710

Institutional Source

Beutler Lab

Gene Symbol

Myh11

Ensembl Gene

ENSMUSG00000018830

Gene Name

myosin, heavy polypeptide 11, smooth muscle

Synonyms

smMHC, SM1, SM2

Accession Numbers

Genbank: NM_013607, NM_001161775

Essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4618001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14194535-14291372 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14201066 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1839 (A1839V)

Ref Sequence

ENSEMBL: ENSMUSP00000087756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: A1839V

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	33	73	1e-15	PFAM
MYSc	79	784	N/A	SMART
IQ	785	807	1.09e-2	SMART
Pfam:Myosin_tail_1	848	1928	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000230397
AA Change: A1839V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000231567
AA Change: A1846V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 93.4%
3x: 91.0%
10x: 85.9%
20x: 75.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,709	D64V	probably damaging	Het
Ankdd1a	A	C	9: 65,507,650	I268S	possibly damaging	Het
Atad3a	C	T	4: 155,750,138	R402Q	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Cd55	C	T	1: 130,456,869	V206I	probably benign	Het
Cd8a	A	G	6: 71,373,677	D42G	possibly damaging	Het
Cemip	G	T	7: 83,943,939	F1185L	probably benign	Het
Cfap58	A	G	19: 47,975,514	D527G	probably damaging	Het
Cyp2a12	C	A	7: 27,034,773	S377Y	probably benign	Het
Dapk2	A	G	9: 66,268,686	D289G	probably benign	Het
Efcab6	G	A	15: 83,983,446	A277V	probably benign	Het
Ephx2	A	T	14: 66,102,222	F250L	probably damaging	Het
Flg2	A	T	3: 93,203,781	S1039C	unknown	Het
Gm609	A	G	16: 45,443,934	F87S	probably benign	Het
Gramd1a	A	G	7: 31,132,596	V674A	probably benign	Het
Gtf2a1	A	C	12: 91,567,769	V237G	probably benign	Het
I830077J02Rik	G	A	3: 105,926,570	T90M	probably damaging	Het
Jagn1	T	A	6: 113,447,437	L90H	probably damaging	Het
Mdn1	G	T	4: 32,746,527	A4158S	probably benign	Het
Olr1	G	A	6: 129,499,906	A132V	probably damaging	Het
Paqr3	A	T	5: 97,103,471	H131Q	possibly damaging	Het
Pde4b	A	T	4: 102,602,812	T397S	probably benign	Het
Pon1	A	G	6: 5,168,349	C353R	probably damaging	Het
Ppie	G	A	4: 123,138,868	T43I	probably null	Het
Prr5l	A	G	2: 101,758,530	F92L	probably damaging	Het
Rai14	T	C	15: 10,575,156	Y601C	probably damaging	Het
Rasal1	A	G	5: 120,670,376	D491G	probably damaging	Het
Rbm12b1	T	A	4: 12,145,441	V471E	probably damaging	Het
Rpusd2	T	C	2: 119,038,452	L452P	possibly damaging	Het
Scgb2b24	A	T	7: 33,738,611	C24S	probably damaging	Het
Slc17a5	C	T	9: 78,538,248	V468M	possibly damaging	Het
Tcp10c	A	G	17: 13,356,510	K117R	possibly damaging	Het
Ubash3b	A	G	9: 41,016,627	S584P	probably benign	Het
Vps13b	C	T	15: 35,709,240	R1778C	probably damaging	Het
Ythdc2	A	G	18: 44,834,598	I220M	probably benign	Het
Zfp474	C	A	18: 52,638,404	T43K	probably damaging	Het
Zscan4-ps3	G	A	7: 11,613,334	M432I	probably benign	Het

Other mutations in Myh11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Myh11	APN	16	14277722	missense	probably benign	0.00
IGL01398:Myh11	APN	16	14202100	missense	probably damaging	0.99
IGL01646:Myh11	APN	16	14221775	missense	probably damaging	1.00
IGL02470:Myh11	APN	16	14218046	missense	probably damaging	1.00
IGL02680:Myh11	APN	16	14209520	missense	probably benign	0.02
IGL02687:Myh11	APN	16	14212618	nonsense	probably null
IGL02987:Myh11	APN	16	14232532	missense	probably damaging	1.00
IGL03008:Myh11	APN	16	14204753	missense	probably benign	0.00
G5030:Myh11	UTSW	16	14250579	missense	probably damaging	1.00
R0008:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0085:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0086:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0087:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0207:Myh11	UTSW	16	14211260	missense	possibly damaging	0.95
R0326:Myh11	UTSW	16	14218880	missense	probably benign	0.32
R0546:Myh11	UTSW	16	14205628	missense	probably damaging	1.00
R0658:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0715:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R0839:Myh11	UTSW	16	14203178	missense	probably damaging	1.00
R1014:Myh11	UTSW	16	14236410	missense	possibly damaging	0.70
R1104:Myh11	UTSW	16	14202127	missense	possibly damaging	0.53
R1426:Myh11	UTSW	16	14205931	nonsense	probably null
R1560:Myh11	UTSW	16	14226620	nonsense	probably null
R1714:Myh11	UTSW	16	14236368	critical splice donor site	probably null
R1742:Myh11	UTSW	16	14220044	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14200758	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14215790	missense	probably damaging	0.98
R1753:Myh11	UTSW	16	14277870	missense	probably benign
R1760:Myh11	UTSW	16	14233695	splice site	probably benign
R1829:Myh11	UTSW	16	14223880	missense	probably damaging	1.00
R1876:Myh11	UTSW	16	14269103	splice site	probably benign
R2027:Myh11	UTSW	16	14232668	missense	probably damaging	1.00
R2122:Myh11	UTSW	16	14218004	missense	probably damaging	1.00
R2247:Myh11	UTSW	16	14277559	missense	probably damaging	1.00
R2495:Myh11	UTSW	16	14205557	missense	probably damaging	1.00
R2863:Myh11	UTSW	16	14239426	missense	probably benign	0.02
R3684:Myh11	UTSW	16	14203234	missense	probably benign	0.00
R3693:Myh11	UTSW	16	14217949	missense	probably benign	0.01
R4080:Myh11	UTSW	16	14224059	missense	possibly damaging	0.83
R4367:Myh11	UTSW	16	14218883	missense	probably damaging	0.97
R4664:Myh11	UTSW	16	14226584	missense	possibly damaging	0.70
R4673:Myh11	UTSW	16	14269241	missense	probably damaging	0.99
R4694:Myh11	UTSW	16	14200702	missense	probably damaging	1.00
R4805:Myh11	UTSW	16	14234465	missense	possibly damaging	0.61
R4806:Myh11	UTSW	16	14201083	splice site	probably null
R4905:Myh11	UTSW	16	14250523	missense	probably benign	0.13
R4939:Myh11	UTSW	16	14239507	missense	probably benign
R4964:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R4966:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R5029:Myh11	UTSW	16	14205625	missense	probably damaging	1.00
R5045:Myh11	UTSW	16	14239527	nonsense	probably null
R5097:Myh11	UTSW	16	14205906	splice site	probably null
R5288:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5385:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5621:Myh11	UTSW	16	14244855	missense	probably damaging	0.96
R5856:Myh11	UTSW	16	14205976	missense	probably benign	0.00
R5869:Myh11	UTSW	16	14230800	missense	probably damaging	1.00
R6019:Myh11	UTSW	16	14206074	missense	probably damaging	1.00
R6024:Myh11	UTSW	16	14277703	missense	probably damaging	0.99
R6139:Myh11	UTSW	16	14215874	missense	probably damaging	1.00
R6209:Myh11	UTSW	16	14208291	nonsense	probably null
R6373:Myh11	UTSW	16	14205130	missense	possibly damaging	0.72
R6671:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R6688:Myh11	UTSW	16	14205553	missense	probably damaging	1.00
R6709:Myh11	UTSW	16	14223494	critical splice donor site	probably null
R7069:Myh11	UTSW	16	14218939	missense	possibly damaging	0.95
R7176:Myh11	UTSW	16	14215826	missense
R7644:Myh11	UTSW	16	14221824	missense
R7838:Myh11	UTSW	16	14209617	missense
R7905:Myh11	UTSW	16	14207681	nonsense	probably null
R8261:Myh11	UTSW	16	14224003	missense
R8272:Myh11	UTSW	16	14218854	missense
R8317:Myh11	UTSW	16	14208077	missense
R8359:Myh11	UTSW	16	14208231	critical splice donor site	probably null
R8486:Myh11	UTSW	16	14204668	missense	possibly damaging	0.77
R8527:Myh11	UTSW	16	14230706	missense	probably damaging	1.00
R8861:Myh11	UTSW	16	14246782	missense
R8886:Myh11	UTSW	16	14234414	missense
R8946:Myh11	UTSW	16	14230716	missense	probably benign	0.08
R9151:Myh11	UTSW	16	14232575	missense
R9253:Myh11	UTSW	16	14256495	missense
R9257:Myh11	UTSW	16	14269256	missense
R9273:Myh11	UTSW	16	14236419	missense
R9320:Myh11	UTSW	16	14211288	missense
R9364:Myh11	UTSW	16	14200716	missense
R9365:Myh11	UTSW	16	14234433	missense
R9496:Myh11	UTSW	16	14230752	nonsense	probably null
R9499:Myh11	UTSW	16	14246809	missense
R9551:Myh11	UTSW	16	14246809	missense
R9554:Myh11	UTSW	16	14200716	missense
R9631:Myh11	UTSW	16	14207577	missense
R9661:Myh11	UTSW	16	14223993	missense
R9679:Myh11	UTSW	16	14277572	missense
R9780:Myh11	UTSW	16	14246749	missense
R9790:Myh11	UTSW	16	14208128	missense
R9791:Myh11	UTSW	16	14208128	missense
X0018:Myh11	UTSW	16	14277633	missense	probably damaging	1.00
X0025:Myh11	UTSW	16	14209689	missense	possibly damaging	0.93
X0027:Myh11	UTSW	16	14234402	missense	probably damaging	1.00
Z1088:Myh11	UTSW	16	14269262	frame shift	probably null
Z1176:Myh11	UTSW	16	14239396	missense	probably null
Z1176:Myh11	UTSW	16	14277775	missense
Z1177:Myh11	UTSW	16	14209595	missense

Predicted Primers

PCR Primer
(F):5'- TGTGTCAGCAAAGGTCAGC -3'
(R):5'- CGGAGTGGCTTATGCTGAAC -3'

Sequencing Primer
(F):5'- CGTAAGGGGTCATGAAGCACC -3'
(R):5'- TCACAAAGGTTCTACAACTGTGC -3'

Posted On

2019-06-07