Incidental Mutation 'PIT4618001:Gm609'
ID555711
Institutional Source Beutler Lab
Gene Symbol Gm609
Ensembl Gene ENSMUSG00000053182
Gene Namepredicted gene 609
SynonymsLOC208166, LOC385647
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location45411768-45492969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45443934 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 87 (F87S)
Ref Sequence ENSEMBL: ENSMUSP00000110233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114585] [ENSMUST00000232138]
Predicted Effect probably benign
Transcript: ENSMUST00000114585
AA Change: F87S

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110233
Gene: ENSMUSG00000053182
AA Change: F87S

DomainStartEndE-ValueType
IG 18 125 2.21e-5 SMART
transmembrane domain 233 255 N/A INTRINSIC
low complexity region 275 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232138
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zfp474 C A 18: 52,638,404 T43K probably damaging Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Gm609
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Gm609 APN 16 45444120 missense probably damaging 1.00
IGL02822:Gm609 APN 16 45442605 missense probably damaging 0.99
R0565:Gm609 UTSW 16 45444173 intron probably benign
R1561:Gm609 UTSW 16 45442512 missense possibly damaging 0.90
R4632:Gm609 UTSW 16 45417908 missense probably benign 0.34
R4667:Gm609 UTSW 16 45444163 missense probably benign 0.01
R5887:Gm609 UTSW 16 45417916 missense probably damaging 0.99
R6181:Gm609 UTSW 16 45417897 missense probably benign 0.01
R6562:Gm609 UTSW 16 45444079 missense probably benign 0.03
R6922:Gm609 UTSW 16 45443931 missense probably benign 0.31
R6961:Gm609 UTSW 16 45444003 missense probably benign 0.32
R7830:Gm609 UTSW 16 45442554 missense probably damaging 1.00
R8133:Gm609 UTSW 16 45443941 missense probably benign
R8459:Gm609 UTSW 16 45417908 missense probably benign 0.06
R8483:Gm609 UTSW 16 45419872 missense possibly damaging 0.92
X0011:Gm609 UTSW 16 45419871 missense possibly damaging 0.92
X0019:Gm609 UTSW 16 45442645 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCCACCTAAGTAACTTGGACC -3'
(R):5'- CACTTATGAGAGGGCTGTCC -3'

Sequencing Primer
(F):5'- AATCACCACCAGCTGTTTATTATC -3'
(R):5'- AGGGCTGTCCTGGGAGG -3'
Posted On2019-06-07