Incidental Mutation 'PIT4618001:Zfp474'
ID555714
Institutional Source Beutler Lab
Gene Symbol Zfp474
Ensembl Gene ENSMUSG00000046886
Gene Namezinc finger protein 474
Synonyms4933409D10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #PIT4618001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location52615915-52639830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52638404 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 43 (T43K)
Ref Sequence ENSEMBL: ENSMUSP00000072453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072666] [ENSMUST00000209270]
Predicted Effect probably damaging
Transcript: ENSMUST00000072666
AA Change: T43K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072453
Gene: ENSMUSG00000046886
AA Change: T43K

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 90 114 1.8e-10 PFAM
Pfam:zf-C2HC_2 161 185 3.3e-13 PFAM
Pfam:zf-C2HC_2 217 241 1.2e-10 PFAM
low complexity region 250 267 N/A INTRINSIC
Pfam:zf-C2HC_2 280 304 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209270
AA Change: T43K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 85.9%
  • 20x: 75.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,709 D64V probably damaging Het
Ankdd1a A C 9: 65,507,650 I268S possibly damaging Het
Atad3a C T 4: 155,750,138 R402Q probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Cd55 C T 1: 130,456,869 V206I probably benign Het
Cd8a A G 6: 71,373,677 D42G possibly damaging Het
Cemip G T 7: 83,943,939 F1185L probably benign Het
Cfap58 A G 19: 47,975,514 D527G probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Dapk2 A G 9: 66,268,686 D289G probably benign Het
Efcab6 G A 15: 83,983,446 A277V probably benign Het
Ephx2 A T 14: 66,102,222 F250L probably damaging Het
Flg2 A T 3: 93,203,781 S1039C unknown Het
Gm609 A G 16: 45,443,934 F87S probably benign Het
Gramd1a A G 7: 31,132,596 V674A probably benign Het
Gtf2a1 A C 12: 91,567,769 V237G probably benign Het
I830077J02Rik G A 3: 105,926,570 T90M probably damaging Het
Jagn1 T A 6: 113,447,437 L90H probably damaging Het
Mdn1 G T 4: 32,746,527 A4158S probably benign Het
Myh11 G A 16: 14,201,066 A1839V Het
Olr1 G A 6: 129,499,906 A132V probably damaging Het
Paqr3 A T 5: 97,103,471 H131Q possibly damaging Het
Pde4b A T 4: 102,602,812 T397S probably benign Het
Pon1 A G 6: 5,168,349 C353R probably damaging Het
Ppie G A 4: 123,138,868 T43I probably null Het
Prr5l A G 2: 101,758,530 F92L probably damaging Het
Rai14 T C 15: 10,575,156 Y601C probably damaging Het
Rasal1 A G 5: 120,670,376 D491G probably damaging Het
Rbm12b1 T A 4: 12,145,441 V471E probably damaging Het
Rpusd2 T C 2: 119,038,452 L452P possibly damaging Het
Scgb2b24 A T 7: 33,738,611 C24S probably damaging Het
Slc17a5 C T 9: 78,538,248 V468M possibly damaging Het
Tcp10c A G 17: 13,356,510 K117R possibly damaging Het
Ubash3b A G 9: 41,016,627 S584P probably benign Het
Vps13b C T 15: 35,709,240 R1778C probably damaging Het
Ythdc2 A G 18: 44,834,598 I220M probably benign Het
Zscan4-ps3 G A 7: 11,613,334 M432I probably benign Het
Other mutations in Zfp474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp474 APN 18 52638493 missense possibly damaging 0.52
IGL01651:Zfp474 APN 18 52638583 missense probably damaging 1.00
IGL01750:Zfp474 APN 18 52639277 missense possibly damaging 0.59
IGL02013:Zfp474 APN 18 52638899 missense possibly damaging 0.86
PIT4469001:Zfp474 UTSW 18 52638719 missense possibly damaging 0.77
R0615:Zfp474 UTSW 18 52638349 missense probably benign 0.02
R1178:Zfp474 UTSW 18 52638742 nonsense probably null
R1180:Zfp474 UTSW 18 52638742 nonsense probably null
R1610:Zfp474 UTSW 18 52638365 missense probably benign
R1819:Zfp474 UTSW 18 52638800 missense probably damaging 1.00
R4854:Zfp474 UTSW 18 52638431 missense possibly damaging 0.59
R6270:Zfp474 UTSW 18 52638364 missense probably benign
R7574:Zfp474 UTSW 18 52639189 missense probably benign 0.00
R8194:Zfp474 UTSW 18 52639157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCAGTCTAAGCAACAG -3'
(R):5'- AATGGCAAGTGACTGGGACC -3'

Sequencing Primer
(F):5'- CAGCCGAGAACCAGTGTG -3'
(R):5'- AAGTGACTGGGACCCGAATTCTC -3'
Posted On2019-06-07