Incidental Mutation 'PIT4449001:Tasp1'
ID555722
Institutional Source Beutler Lab
Gene Symbol Tasp1
Ensembl Gene ENSMUSG00000039033
Gene Nametaspase, threonine aspartase 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #PIT4449001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location139833480-140066805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139910535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 328 (I328T)
Ref Sequence ENSEMBL: ENSMUSP00000039546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046656] [ENSMUST00000099304] [ENSMUST00000110079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046656
AA Change: I328T

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039546
Gene: ENSMUSG00000039033
AA Change: I328T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 346 1.1e-50 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099304
SMART Domains Protein: ENSMUSP00000096907
Gene: ENSMUSG00000039033

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 286 1.1e-46 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110079
AA Change: I328T

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105706
Gene: ENSMUSG00000039033
AA Change: I328T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 348 1.3e-62 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display prenatal and early postnatal lethality, reduced body size, impaired suckling behavior, homeotic transformations of the axial skeleton, and cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Tasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Tasp1 APN 2 139977618 missense probably damaging 1.00
IGL01476:Tasp1 APN 2 140008773 missense probably benign 0.01
IGL02876:Tasp1 APN 2 139834363 missense probably benign 0.45
R0352:Tasp1 UTSW 2 139951458 critical splice donor site probably null
R0381:Tasp1 UTSW 2 139951483 missense probably damaging 1.00
R1056:Tasp1 UTSW 2 140008764 missense possibly damaging 0.94
R1350:Tasp1 UTSW 2 140057421 missense probably damaging 1.00
R1836:Tasp1 UTSW 2 139951557 missense probably damaging 1.00
R2005:Tasp1 UTSW 2 139977678 missense probably damaging 1.00
R2129:Tasp1 UTSW 2 140048244 missense possibly damaging 0.75
R2259:Tasp1 UTSW 2 139951506 missense probably damaging 1.00
R2321:Tasp1 UTSW 2 140057412 missense probably benign 0.05
R3700:Tasp1 UTSW 2 139910554 missense probably benign 0.00
R3842:Tasp1 UTSW 2 139951501 missense probably damaging 1.00
R5526:Tasp1 UTSW 2 140008789 missense probably damaging 1.00
R5724:Tasp1 UTSW 2 140057419 missense probably damaging 0.99
R6345:Tasp1 UTSW 2 139951537 missense probably damaging 1.00
R6533:Tasp1 UTSW 2 139834357 makesense probably null
R7723:Tasp1 UTSW 2 139985131 missense probably damaging 1.00
R7796:Tasp1 UTSW 2 140008785 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTCTCAGAATCTAGACACTAAAGTAG -3'
(R):5'- GTCCTGCAACGGAACTACTTG -3'

Sequencing Primer
(F):5'- AGTTGAATTGCTGATATCATGCTG -3'
(R):5'- TACTTGTAAGTAGTGCACAAGGG -3'
Posted On2019-06-07