Incidental Mutation 'PIT4449001:Lingo4'
ID555724
Institutional Source Beutler Lab
Gene Symbol Lingo4
Ensembl Gene ENSMUSG00000044505
Gene Nameleucine rich repeat and Ig domain containing 4
SynonymsLrrn6d, LERN4, A530050P17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #PIT4449001 (G1)
Quality Score158.009
Status Not validated
Chromosome3
Chromosomal Location94398517-94404501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94401932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000058050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000050975] [ENSMUST00000197040] [ENSMUST00000200009]
Predicted Effect probably benign
Transcript: ENSMUST00000029795
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050975
AA Change: V59A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058050
Gene: ENSMUSG00000044505
AA Change: V59A

DomainStartEndE-ValueType
LRRNT 55 89 1.23e-4 SMART
LRR 88 107 2.76e2 SMART
LRR_TYP 108 131 1.02e-6 SMART
LRR_TYP 132 155 7.26e-3 SMART
LRR 156 179 1.33e1 SMART
LRR_TYP 180 203 5.42e-2 SMART
LRR 204 227 4.45e1 SMART
LRR 228 251 3.27e1 SMART
LRR 300 323 4.83e0 SMART
LRR 324 347 3.07e-1 SMART
LRR 348 371 3.36e1 SMART
LRRCT 383 436 5.24e-5 SMART
IGc2 451 516 3.53e-13 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200009
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Lingo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Lingo4 APN 3 94403288 missense probably benign 0.00
IGL02662:Lingo4 APN 3 94401817 unclassified probably benign
IGL02687:Lingo4 APN 3 94402097 missense probably damaging 1.00
IGL02711:Lingo4 APN 3 94403393 missense probably benign
IGL03001:Lingo4 APN 3 94402396 missense probably damaging 1.00
IGL03260:Lingo4 APN 3 94401943 missense probably benign
R0088:Lingo4 UTSW 3 94402033 missense probably benign 0.39
R0616:Lingo4 UTSW 3 94403081 missense probably benign 0.00
R1455:Lingo4 UTSW 3 94399392 unclassified probably benign
R1733:Lingo4 UTSW 3 94403178 missense probably benign 0.00
R2001:Lingo4 UTSW 3 94403075 missense probably damaging 1.00
R2085:Lingo4 UTSW 3 94402245 missense probably damaging 1.00
R3793:Lingo4 UTSW 3 94402378 missense probably benign
R3805:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R3806:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R4438:Lingo4 UTSW 3 94402897 missense possibly damaging 0.79
R4660:Lingo4 UTSW 3 94403365 missense probably benign 0.00
R4724:Lingo4 UTSW 3 94402876 nonsense probably null
R4981:Lingo4 UTSW 3 94399454 missense probably benign 0.18
R4994:Lingo4 UTSW 3 94402541 missense probably benign
R4994:Lingo4 UTSW 3 94403001 missense probably benign 0.02
R5600:Lingo4 UTSW 3 94401913 missense probably benign
R6188:Lingo4 UTSW 3 94402850 missense probably damaging 1.00
R6267:Lingo4 UTSW 3 94403390 missense probably benign 0.02
R6303:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6304:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6789:Lingo4 UTSW 3 94399355 unclassified probably benign
R7313:Lingo4 UTSW 3 94403144 missense possibly damaging 0.95
R7329:Lingo4 UTSW 3 94402855 missense probably benign
R7631:Lingo4 UTSW 3 94399460 missense possibly damaging 0.93
R7908:Lingo4 UTSW 3 94402234 missense probably benign 0.19
R7989:Lingo4 UTSW 3 94402234 missense probably benign 0.19
X0054:Lingo4 UTSW 3 94403376 missense possibly damaging 0.54
Z1177:Lingo4 UTSW 3 94402994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCACCACCATCTGAAG -3'
(R):5'- TGAGTAGACTTTGTAGGCCATG -3'

Sequencing Primer
(F):5'- TCTGAAGCCACTTTTCAAAAGAGAC -3'
(R):5'- CTTTGTAGGCCATGGAAAGC -3'
Posted On2019-06-07