Incidental Mutation 'PIT4449001:Wars2'
ID555725
Institutional Source Beutler Lab
Gene Symbol Wars2
Ensembl Gene ENSMUSG00000004233
Gene Nametryptophanyl tRNA synthetase 2 (mitochondrial)
Synonyms9430020O07Rik, TrpRS
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4449001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location99141068-99239186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 99205279 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 162 (V162L)
Ref Sequence ENSEMBL: ENSMUSP00000004343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004343] [ENSMUST00000135960] [ENSMUST00000145650] [ENSMUST00000198044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004343
AA Change: V162L

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004343
Gene: ENSMUSG00000004233
AA Change: V162L

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 30 315 2.7e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135960
AA Change: V162L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142470
Gene: ENSMUSG00000004233
AA Change: V162L

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 30 175 1e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145650
AA Change: V162L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142723
Gene: ENSMUSG00000004233
AA Change: V162L

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 30 178 1.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198044
AA Change: V76L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142361
Gene: ENSMUSG00000004233
AA Change: V76L

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 25 92 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. This gene encodes the mitochondrial tryptophanyl-tRNA synthetase. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit decreased body fat mass, cardiomyopathy, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Wars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Wars2 UTSW 3 99214774 frame shift probably null
R0511:Wars2 UTSW 3 99216549 missense probably damaging 1.00
R0748:Wars2 UTSW 3 99216572 missense probably damaging 1.00
R1446:Wars2 UTSW 3 99187527 missense probably benign 0.12
R1534:Wars2 UTSW 3 99216861 missense probably damaging 1.00
R2118:Wars2 UTSW 3 99216567 missense probably benign 0.06
R4246:Wars2 UTSW 3 99216588 missense probably damaging 0.99
R5069:Wars2 UTSW 3 99187533 missense probably damaging 1.00
R5973:Wars2 UTSW 3 99187646 missense probably benign
R6518:Wars2 UTSW 3 99216800 missense probably benign
R7098:Wars2 UTSW 3 99216641 missense probably damaging 1.00
R8010:Wars2 UTSW 3 99216830 missense probably benign 0.01
R8247:Wars2 UTSW 3 99187649 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGAGCTGCTGAAAGGGACC -3'
(R):5'- ACGTCAAACCTTTTCCTGAGAG -3'

Sequencing Primer
(F):5'- CCGAAATATATGTTATTACAGGTGGC -3'
(R):5'- GAGTTAAAAACACTCTCATGTGGCAC -3'
Posted On2019-06-07